Documente online.
Username / Parola inexistente
  Zona de administrare documente. Fisierele tale  
Am uitat parola x Creaza cont nou
  Home Exploreaza
Upload




























MODIFICAZIONI DELLA REGOLAZIONE GENICA INDOTTE DALLO STRESS CRONICO IN UN MODELLO PRECLINICO DI DEPRESSIONE: EFFETTI DELL'ANTIPSICOTICO ATIPICO QUETIAPINA

Italiana




UNIVERSITA' DEGLI STUDI DI MILANO

Facoltà di Scienze Matematiche, Fisiche e Naturali

Corso di Laurea in Scienze Biologiche



MODIFICAZIONI DELLA REGOLAZIONE GENICA INDOTTE DALLO STRESS CRONICO IN UN MODELLO PRECLINICO DI DEPRESSIONE: EFFETTI DELL'ANTIPSICOTICO ATIPICO QUETIAPINA

Relatore:  Dott.ssa Mariaelvina SALA

Correlatore:  Prof. Marco ORSETTI

Tesi di laurea di:

Federica PODETTA

Matr. n. 512572

Anno Accademico 2005-2006

"Non c'è una cellula, un atomo,

una virgola che possa sfuggire

all'unità del cosmo.

C'è ovunque il segno di Dio.

.il segno non cesserà di

Interrogarmi." 

a mamma e papà

a Massimo

INDICE

INTRODUZIONE

I disturbi affettivi

Il disturbo depressivo maggiore

1.1.2 Il disturbo bipolare

Neurobiologia della depressione

Ipotesi monoaminergica

Oltre l'ipotesi monoaminergica

1.2.3 Ruolo dello stress nei disturbi affettivi

Test preclinici per la valutazione dell'attivita' degli antidepressivi

Asportazione dei bulbi olfattivi

Test del nuoto forzato o test di porsolt

Learned helplessness

Stress cronico variato

1.3.5 Ratti con fenotipo swlo e swhi

Gli antipsicotici atipici nel trattamento dei disturbi affettivi

Definizione di antipsicotico atipico

1.4.2 Basi farmacologiche dell'atipicità

1.4.3 Clozapina

1.4.4 Olanzapina

Risperidone

1.4.6 Quetiapina

SCOPO DELLA TESI

MATERIALI E METODI

Stress cronico variato (cms)

Stabulazione e manipolazione degli animali

Scelta dei ratti preferenti al saccarosio

Induzione dell'anedonia

Valutazione dello stato anedonico

Trattamento e prelievo delle aree

3.1.6 Estrazione di rna

DNA microarray

RT-PCR real-time

3.3.1 Preparazione primers per il settaggio della real-time

3.3.2 Preparazione della curva di taratura

3.3.3 Preparazione dei campioni

RT-PCR semiquantitativa

3.4.1 Retrotrascrizione

Amplificazione

Corsa elettroforetica

RISULTATI

DISCUSSIONE

BIBLIOGRAFIA

INTRODUZIONE

I DISTURBI AFFETTIVI

Il Manuale Diagnostico e Statistico delle Malattie Mentali (DSM-IV TR) descrive due disturbi dell'umore, il disordine depressivo maggiore o disturbo unipolare e il disturbo bipolare, suddivisi a loro volta in diversi sottotipi (Kandel e coll. 1994).

IL DISTURBO DEPRESSIVO MAGGIORE

Il disordine depressivo maggiore (DDM) è uno dei disturbi psichiatrici più diffusi e la sua frequenza negli ultimi decenni sembra essere in costante aumento, non solo nella popolazione adulta e anziana, ma anche tra gli adolescenti.

Il picco di comparsa della malattia è compreso tra i 20 e i 40 anni di età. Il DDM è una patologia disabilitante che colpisce il 7-15% degli uomini e il 13-28% delle donne, esercitando importanti effetti sul comportamento individuale e sociale e soprattutto sulla capacità del soggetto malato di operare normalmente all'interno della società.

Tale disturbo rappresenta una fonte significativa di sofferenza per i pazienti che ne sono afflitti e per i loro familiari, in quanto tende a cronicizzare e può durare per l'intero arco della vita (Weisman e coll. 1998).

Come definito dall'APA, l'American Psychiatric Association, il DDM è una patologia eterogenea, che si manifesta spesso con sintomi che abbracciano l'area psicologica, comportamentale e fisiologica. Pertanto la diagnosi è affidata alla valutazione di un'ampia gamma di manifestazioni cliniche. La diversità dei sintomi, variabili per definizione, interessa l'ambito emotivo-affettivo (ricorrenti sentimenti di colpa e autoriduttivi, diminuzione dell'autostima), le funzioni vegetative (disturbi del ciclo sonno-veglia, dell'appetito e del comportamento sessuale), l'ambito psicomotorio (eloquio alterato, agitazione psicomotoria e iperattività o rallentamento e a 515g621f patia) e la sfera cognitiva (disturbi della memoria, minore capacità di concentrazione ed attenzione, ricorrenti pensieri di morte e ideazione suicidaria). E' stato stimato che il suicidio costituisca la causa di morte del 15% dei pazienti depressi.

Il DDM rappresenta perciò una sindrome multifattoriale ed eterogenea (Rossi, Cuomo e Riccardi, 2005) che può provocare patologie di interesse medico generale. Alcuni autori sostengono infatti che il DDM rappresenti uno dei maggiori rischi di insorgenza di patologie cardiovascolari (Starkstein e coll. 1989). Inoltre sintomi depressivi, difficilmente distinguibili dalla depressione maggiore, si verificano in svariate condizioni mediche come disturbi endocrini, disturbi vascolari, morbo di Parkinson, alcuni tumori, diabete e ictus (Starkstein e coll. 1996). Caratteristica peculiare del DDM è la sua ciclicità: nell'arco della vita del paziente esiste un'alta probabilità che l'episodio di malattia si riproponga periodicamente, anche a distanza di tempo rispetto alla prima manifestazione. Il 93% dei soggetti che ha sperimentato un primo episodio depressivo, ne sviluppa un secondo in un periodo successivo della propria esistenza, il 60% entro 5 anni dal primo episodio. Alla luce di queste osservazioni si comprende perché la terapia del DDM necessiti di un trattamento farmacologico cronico.

Studi epidemiologici hanno dimostrato come il 40-50% dei casi di DDM sia legato a fattori ereditari: analisi su famiglie hanno evidenziato un più alto rischio di incidenza della patologia tra i parenti di primo grado di individui depressi (Gershon e coll. 1987).

Tuttavia contribuiscono alla vulnerabilità soggettiva nei confronti della depressione altri fattori non ereditari, sia endogeni che non, come lo stress, i traumi emozionali (malattie, lutti), i fattori ambientali, le infezioni virali e altri eventi dannosi verificatisi durante lo sviluppo.

L'elevata frequenza dei disturbi affettivi nei giovani sembra poi correlabile ad elementi di ordine sociale, culturale ed ambientale (disconoscimento di valori fondamentali, trasformazione dei modelli culturali, cambiamento della struttura familiare, tendenza all'individualismo e alla competizione), oltre all'uso di sostanze psicotrope e farmaci.

Secondo il DSM IV-TR, il DDM è un disturbo dell'affettività caratterizzato dalla profonda riduzione del tono dell'umore e da anedonia, cioè dalla progressiva perdita di interesse e piacere per attività normalmente gratificanti.

Oltre a questi due sintomi cardine, il DDM in fase conclamata, si manifesta tuttavia con una pletora di altri sintomi, quali tristezza, pessimismo, rallentamento dell'ideazione e dell'attività motoria, riduzione dell'autostima e della fiducia in se stessi, difficoltà a svolgere le normali attività della vita quotidiana, tendenza al pianto e ansia. Disturbi neurovegetativi frequenti sono rappresentati da alterazioni dell'appetito, con conseguente aumento o perdita di peso, e disturbi del sonno, con conseguente insonnia o ipersonnia. Nel complesso, il DDM è una condizione dominata da sentimenti spiacevoli e negativi riguardanti se stessi e il mondo circostante e dalla conseguente difficoltà a programmare il futuro. Secondo il DSM IV-TR, un paziente è affetto da DDM quando, in assenza di altre patologie, presenta tutti i giorni per almeno due settimane almeno cinque dei sintomi riportati nella Tabella 1, di cui almeno uno deve essere anedonia o umore depresso. Inoltre i sintomi devono essere tali da impedirgli di svolgere le normali attività sociali ed occupazionali.

Una forma di depressione più lieve rispetto al DDM, caratterizzata da sintomi meno gravi dal punto di vista sociale e lavorativo, è la distimia. Nell'individuo affetto da disturbo distimico i sintomi depressivi, sfumati ma costanti, possono essere considerati una caratteristica peculiare della personalità. Infatti tale patologia spesso non viene diagnosticata e, di conseguenza, il paziente non riceve un adeguato trattamento farmacologico. In molti casi, tuttavia, anche il trattamento farmacologico può non essere del tutto efficace e il paziente affetto da distimia non ritorna allo stato eutimico.

Tabella 1. Criteri per la diagnosi del Disturbo DDM

Cinque (o più) dei seguenti sintomi devono essere contemporaneamente presenti durante un periodo di 2 settimane e devono rappresentare un cambiamento rispetto al precedente livello di funzionamento; almeno uno dei sintomi è costituito da umore depresso o anedonia (perdita di interesse o piacere).

Umore depresso per la maggior parte del giorno, quasi ogni giorno, come riferito dal soggetto (per es., l'individuo si sente triste o vuoto) o come osservato dagli altri (per es., appare lamentoso). Nei bambini e negli adolescenti lo stato d'animo depresso può manifestarsi come irritabilità.

Marcata diminuzione di interesse o piacere per tutte, o quasi tutte, le attività per la maggior parte del giorno, quasi ogni giorno (come riportato dal soggetto o come osservato dagli altri).

Significativa perdita di peso, senza che il soggetto sia in regime di dieta, o aumento di peso (per es., un cambiamento superiore al 5% del peso corporeo in un mese); diminuzione o aumento dell'appetito quasi ogni giorno. Nei bambini, si osserva l'incapacità di raggiungere i normali livelli ponderali.

Insonnia o ipersonnia quasi ogni giorno.

Agitazione o rallentamento psicomotorio quasi ogni giorno (osservabile dagli altri, non semplicemente percepibile dal soggetto come irrequietezza o rallentamento)

Spossatezza, stanchezza o mancanza di energia quasi ogni giorno (rallentamento del livello di attività: il depresso si sente apatico e indolente).

Sentimenti di autosvalutazione (concetto negativo di sé), sentimenti di colpa eccessivi o inappropriati (che possono essere deliranti), quasi ogni giorno (non semplice autoaccusa o sentimenti di colpa per essere ammalato).

Ridotta capacità di pensare e di concentrarsi o indecisione quasi ogni giorno (come impressione soggettiva o osservata dagli altri).

Pensieri ricorrenti di morte (non solo paura di morire), ricorrente ideazione suicidaria senza un piano specifico, o tentativo di suicidio e ideazione di un piano specifico per commetterlo.

I sintomi devono causare un disagio clinicamente significativo o compromissione dell'interazione sociale, lavorativa o di altre aree importanti.

I sintomi non devono essere dovuti agli effetti fisiologici diretti di una sostanza (per es., una droga d' abuso, un medicamento) o di una condizione patologica generale (per es., ipotiroidismo).

IL DISTURBO BIPOLARE

Il disturbo bipolare (BD) è un disordine affettivo in cui il paziente sperimenta non solo il quadro clinico caratteristico della depressione, analogo a quello descritto per il DDM, ma anche lo stato maniacale. Negli individui affetti da BD si manifestano episodi ciclici di depressione e di mania che possono permanere da alcune settimane ad alcuni mesi.

Kandel e coll. (1994) hanno sottolineato che il 25% dei soggetti affetti da DDM possono incorrere durante l'intero arco della loro vita in almeno un episodio maniacale, ma che si possa diagnosticare il BD soltanto quando si constati l'incidenza regolare di diversi eventi depressivi e maniacali.

Anche il BD infatti è un disturbo ricorrente: dopo il primo episodio maniacale, altri episodi, sia di depressione che di mania, si succedono con una frequenza doppia rispetto alla frequenza del DDM (Kandel e coll. 1994; Goodwin e Janison, 1990).

Secondo il DSM IV-TR lo stato maniacale è caratterizzato da una sintomatologia esattamente opposta a quella dello stato depressivo. Durante la fase maniacale il soggetto affetto da BD presenta per circa una settimana in modo continuativo un tono dell'umore persistentemente elevato, risulta pervaso da un grande eccitamento, da una sensazione di esaltazione e di euforia che lo porta ad una estrema iperattività, ad una illimitata fiducia nelle proprie capacità e ad idee di grandezza. Poiché spesso tali individui possono percepire la realtà in modo distorto e poiché non sono consapevoli dei propri limiti, facilmente possono incorrere in esperienze rischiose. Inoltre la loro prorompente vitalità spesso sfocia nell'impazienza e nell'irritabilità o nella facile distraibilità da parte di stimoli esterni con conseguente diminuzione del livello di vigilanza. Anche la sfera vegetativa risulta alterata con un'aumento della libido, insonnia e iperfagia (Tabella 2).

Tra un episodio depressivo ed uno maniacale si possono presentare anche stati di umore misto o lunghi periodi di remissione durante i quali il paziente è eutimico e non presenta disturbi di alcun genere. In altri casi gli episodi depressivi e maniacali si succedono senza alcun ritorno allo stato eutimico.

Talvolta si possono riscontrare alterazioni dell'umore più lievi, come la ciclotimia, che si possono presentare anche nell'arco della stessa giornata, ma che non raggiungono l'intensità dell'episodio di depressione o di mania. Pochissimi individui soffrono solo di eventi maniacali ricorrenti, senza episodi depressivi.

Infine una piccola percentuale di pazienti bipolari, di cui l'80% sono donne, presenta un'alternanza rapida tra depressione e mania; tale rapidità di ciclo sembra correlabile con una disfunzione della tiroide. Numerosi studi clinici attribuiscono ad una scorretta terapia con antidepressivi triciclici l'insorgenza di questa rapida alternanza. L'interruzione del trattamento con triciclici e la somministrazione di composti tiroidei e sali di litio sembra consentire il ripristino della normale ciclicità (Pletscher, Shore e Brodie, 1956; Goodwin e Jamison, 1990).

Sembra che, oltre al BD a cicli rapidi, anche altri sottotipi di BD, non rispondano in modo completo alle terapie attualmente disponibili. Questi disturbi presentano perciò un alto tasso di ricadute e refrattarietà al trattamento (Coryell e coll. 1992).

E' possibile distinguere tra BD di tipo I, che si manifesta nell'1% della popolazione con i sintomi classici di mania e depressione, e BD di tipo II, che ha un'incidenza dello 0,6% nella popolazione ed è caratterizzato da episodi ipomaniacali. In quest'ultimo, meno grave rispetto al BD di tipo I, l'ipomania può anche rivelarsi come aumentata creatività del soggetto e non sempre vengono compromessi i rapporti interpersonali. L'episodio di ipomania non è associato al danneggiamento della capacità di giudizio e anzi può sfociare in un miglioramento della capacità e dell'efficienza (Bear e Canard, 2002).

Tabella 2. Criteri per la diagnosi del BD

Un periodo definito di umore anormale e persistentemente elevato, espansivo o irritabile, della durata di almeno una settimana (o di qualsiasi durata se è necessaria l'ospedalizzazione).

Durante il periodo di alterazione dell'umore, tre (o più) dei seguenti sintomi sono stati persistenti e presenti a un livello significativo (quattro se l'umore è solo irritabile):

Autostima ipertrofica o grandiosità.

Diminuito bisogno di sonno (per es., l'individuo si sente riposato dopo solo 3 ore di sonno).

Maggiore loquacità rispetto al solito, oppure spinta continua a parlare.

Fuga delle idee o esperienza soggettiva che i pensieri si succedano rapidamente.

Distraibilità (cioè l'attenzione e la vigilanza dell'individuo è troppo facilmente deviata da stimoli esterni non importanti o non pertinenti).

Aumento dell'attività finalizzata (sociale, lavorativa, scolastica o sessuale) oppure agitazione psicomotoria.

Eccessivo coinvolgimento in attività ludiche che hanno un alto potenziale di conseguenze dannose (per es., eccessi nel comprare, comportamento sessuale sconveniente, investimenti in affari avventati).

L'alterazione dell'umore è sufficientemente grave da causare una marcata compromissione dell'attività lavorativa o delle attività sociali abituali o delle relazioni interpersonali o tale da richiedere l'ospedalizzazione per prevenire danni a sé o agli altri; oppure sono presenti manifestazioni psicotiche.

I sintomi non sono dovuti agli effetti fisiologi diretti di una sostanza (per es., una droga d'abuso, un farmaco, o un altro trattamento) o ad una condizione medica patologica generale (per es., ipertiroidismo).

NEUROBIOLOGIA DELLA DEPRESSIONE

IPOTESI MONOAMINERGICA

Nonostante il grande impatto sociale dei disturbi dell'umore, a tutt'oggi poco si conosce circa la loro eziologia e la loro patogenesi.

Negli anni '50 si osservò casualmente che la reserpina, un farmaco normalmente utilizzato per il trattamento dell'ipertensione, era in grado di indurre uno stato depressivo. Tale sostanza causa la deplezione della noradrenalina (NA) e della serotonina (5-HT) a livello sinaptico in quanto blocca lo storage di questi neurotrasmettitori nelle vescicole sinaptiche, favorendo il loro rilascio nel citoplasma, dove vengono ossidate dalle monoaminoossidasi (MAO). In conseguenza di ciò, viene ridotta la disponibilità neuronale di NA e 5-HT e, dopo alcuni giorni, si verifica l'arresto dell'attività sinaptica (Kandel e coll. 1994; Rang e coll. 2005).

Nello stesso periodo storico un altro farmaco, l'isoniazide, utilizzato per la terapia della tubercolosi, aveva dimostrato di esercitare, come effetto secondario, un miglioramento del tono dell'umore.

L'iproniazide, un analogo strutturale dell'isoniazide, fu pertanto utilizzato con successo per il trattamento della depressione nella prima metà degli anni '60. Oggi è noto che l'iproniazide è un inibitore irreversibile e non selettivo delle MAO, capace di ridurre la velocità di degradazione della NA e della 5-HT all'interno dei neuroni, accrescendone così la disponibilà sinaptica (Kandel e coll. 1994).

Lo studio del meccanismo d'azione dell'imipramina, un farmaco triciclico introdotto in terapia come antidepressivo nei primi anni '60, ha permesso di chiarire che la sua efficacia terapeutica, è determinata dalla capacità di inibire la ricaptazione neuronale di NA e 5-HT e dal conseguente potenziamento della trasmissione noradrenergica e serotoninergica (Kandel e coll. 1994; Blier e De montigny,1994).

Queste ed altre osservazioni cliniche e sperimentali hanno consentito a Schildkraut, verso la fine degli anni '60, di formulare la prima ipotesi sulla possibile patogenesi della depressione, la cosiddetta ipotesi monoaminergica. Secondo Schildkraut, la depressione potrebbe essere determinata da un deficit di NA, di 5-HT e, in misura minore, di dopamina (DA)( Sullivan e coll. 2000) a livello delle sinapsi del sistema nervoso centrale (SNC). Tale ipotesi è suffragata dall'osservazione che le prime classi di farmaci efficaci nel trattamento della depressione, gli antidepressivi triciclici e gli inibitori delle monoaminoossidasi, facilitano e potenziano la neurotrasmissione monoaminergica, soprattutto noradrenergica e serotoninergica. Tali farmaci infatti aumentano la concentrazione di NA e 5-HT a livello sinaptico, i triciclici attraverso l'inibizione della ricaptazione neuronale delle monoamine e gli inibitori delle MAO attraverso il blocco della loro degradazione.

I sistemi monoaminergici hanno una distribuzione diffusa in tutto il SNC, in particolare in alcune aree, quali la corteccia frontale, lo striato e il sistema limbico. Tali aree presentano un elevato livello di integrazione e di interconnessioni reciproche e formano un network in grado di regolare l'emotività, la sfera cognitiva ed affettiva e di coordinare le risposte motorie, comportamentali e vegetative ad esse correlate.

Le vie serotoninergiche, che originano nei nuclei del rafe, regolano diverse funzioni quali la memoria, lo stato dell'umore, il sonno, l'appetito, il vomito, l'attività sessuale, la temperatura corporea.

La maggior parte dei neuroni noradrenergici origina invece dal locus coeruleus e regola le funzioni cognitive, le risposte emotive, il tono dell'umore, l'attenzione, la motivazione e, attraverso il sistema ortosimpatico, le funzioni cardiovascolari e della gran parte degli organi interni.

Negli anni passati, allo scopo di verificare l'ipotesi monoaminergica, sono stati effettuati numerosi studi per valutare le modificazioni della concentrazione di NA, di 5-HT e dei loro metaboliti nei liquidi biologici (fluido cerebrospinale, sangue, urine) e nei tessuti cerebrali dei pazienti affetti da depressione o mania e per valutare l'efficacia dei precursori della 5-HT nella terapia della depressione.

Il principale metabolita centrale della NA è l'MHPG (3-metossi-4-idrossi-feniletilenglicole), la cui concentrazione è stata studiata per lo più nell'urina, in quanto i suoi livelli liquorali sembrano rappresentare un indice del metabolismo noradrenergico spinale più che cerebrale. Evidenze sperimentali suggeriscono che il 20-80% dell'MHPG eliminato con l'urina deriva dal metabolismo della NA a livello cerebrale. Rispetto ai soggetti normali, nei pazienti bipolari si sono riscontrati livelli medi di MHPG significativamente ridotti durante la fase depressiva e lievemente ridotti nella fase maniacale. Nei pazienti depressi unipolari sono stati invece rilevati livelli di MHPG ridotti, più elevati o uguali rispetto ai controlli. Probabilmente i livelli più elevati di NA rilevati nei pazienti depressi rispetto ai soggetti normali riflettono l'aumento dell'attività simpatica periferica causata dall'ansia, spesso associata alla depressione (Paoletti e coll, 1999). Livelli urinari ridotti di MHPG sono stati riscontrati in pazienti unipolari durante la fase acuta della malattia, ma negli stessi pazienti le concentrazioni di MHPG tendono a normalizzarsi con la risoluzione dell'episodio depressivo. Questo dato ha portato ad ipotizzare che i livelli urinari di MHPG riflettano alterazioni transitorie e contingenti legate alla fase della malattia piuttosto che alla presenza della patologia stessa. Inoltre, alcuni autori sostengono che l'escrezione urinaria di questo metabolita sia influenzata da una serie di variabili aspecifiche, come l'ttività motoria, il regime alimentare e il ciclo sonno-veglia. Pertanto la valutazione della concentrazione urinaria di MHPG non sembra avere valore predittivo e non avvalora l'ipotesi monoaminergica.

Il principale metabolita della 5-HT a livello cerebrale è il 5-HIAA (acido 5-idrossi-indolacetico). Anche i dati relativi alle concentrazioni di 5-HIAA nei liquor e nell'urina dei pazienti depressi appaiono discordanti. Alcuni studi hanno riportato livelli ridotti del metabolita in circa il 30-40% dei pazienti depressi, mentre in altri non è stata rilevata alcuna significativa differenza rispetto ai soggetti di controllo. Altri studi hanno suggerito una probabile correlazione tra bassi livelli di 5-HIAA e comportamento suicidario (maggiore frequenza di tentativi di suicidio) (Mann e coll. 1999). Gli autori, partendo dal presupposto che i bassi livelli di 5-HIAA fossero una conseguenza della carenza di 5-HT cerebrale, si sarebbero aspettati un aumento dei livelli del metabolita in seguito al trattamento con antidepressivi, almeno nei pazienti rispondenti alla terapia, ma i risultati delle analisi hanno fornito dati contrastanti e spesso di difficile interpretazione. Nel loro complesso questi studi non hanno fornito dati sufficienti a dimostrare una correlazione tra concentrazioni di 5-HIAA nei liquidi biologici e il DDM.

Per quanto concerne gli studi clinici sull'efficacia antidepressiva di precursori della serotonina come il L-triptofano (TRP) e il 5-idrossi-triptofano (5-HTP), tali precursori non hanno prodotto risultati significativi e l'efficacia di questi farmaci risulta essere per lo più modesta.

La stessa osservazione "storica" sulle proprietà depressive della reserpina è stata recentemente riconsiderata. Goodwin e coll. (1990) hanno osservato che solo una piccola percentuale di pazienti (5-10%) trattati con reserpina sviluppano una vera e propria sintomatologia depressiva, mentre la maggior parte presenta una condizione "pseudo-depressiva" caratterizzata soprattutto da sedazione e letargia.

E' stato infine sottolineato che l'inibizione della ricaptazione delle monoamine cerebrali, con il conseguente potenziamento della trasmissione monoaminergica, debba essere considerato come il meccanismo iniziale (acuto) dell'azione antidepressiva e che non possa di per sé mediare gli effetti terapeutici di questi farmaci. Infatti la risposta terapeutica si manifesta dopo alcune settimane rispetto all'inizio della terapia. Livelli plasmatici di antidepressivo efficaci nel produrre il blocco della ricaptazione e il potenziamento monoaminergico si raggiungono dopo poche ore, in altre parole gli effetti del farmaco sui principali bersagli molecolari sono osservabili in tempi brevi, ma l'effetto terapeutico nei confronti dei sintomi depressivi compare dopo almeno 4-6 settimane di trattamento. Per spiegare questo periodo di latenza nella comparsa dell'effetto antidepressivo, è stata avanzata l'ipotesi che la somministrazione cronica del farmaco inneschi risposte adattative da parte dell'organismo e che siano questi meccanismi omeostatici i veri responsabili dell'efficacia terapeutica.

D'altra parte non esistono evidenze dirette che la principale causa della depressione siano le anomalie dei meccanismi che controllano la neurotrasmissione monoaminergica. Gli studi in parte sopra descritti non hanno definito con chiarezza il contributo di tali sistemi neurochimici all' eziopatogenesi della depressione. Quindi, per quanto la disregolazione dei sistemi monoaminergici sia certamente coinvolta nei disturbi dell'umore, essa non è sicuramente l'elemento scatenante che determina l'insorgenza della patologia.

Inoltre non tutti i farmaci che sono in grado di aumentare la neurotrasmissione noradrenergica e serotoninergica, come per esempio gli psicostimolanti, sono farmaci antidepressivi.

Al contrario non tutti i farmaci dotati di attività antidepressiva sono in grado di inibire significativamente la ricaptazione sinaptica delle monoamine, come ad esempio l'iprindolo.

OLTRE L'IPOTESI MONOAMINERGICA

Per quanto sia evidente la compromissione dei sistemi monoaminergici nella depressione, un semplice "modello sinaptico" non può spiegare in modo esaustivo l'eziopatogenesi della malattia.

I più recenti sviluppi della ricerca nel campo dei disturbi affettivi hanno consentito di sviluppare altre ipotesi sui possibili meccanismi cellulari che sottendono la fisiopatologia della depressione, non necessariamente in contraddizione con la precedente ipotesi monoaminergica.

Tali ipotesi offrono anche una convincente interpretazione del meccanismo d'azione dei farmaci antidepressivi. Questi composti agirebbero modificando gli eventi regolatori intraneuronali, con una sequenzialità temporale sovrapponibile alla latenza necessaria per la comparsa dell'effetto terapeutico. Gli antidepressivi non sarebbero soltanto in grado di interferire con la ricaptazione delle monoamine, ma anche con i meccanismi di trasduzione del segnale promossi da questi stessi neurotrasmettitori, innescando processi adattativi specifici nei pathways di segnalazione intracellulare (Manji e coll. 2000; Manji e coll. 2000).

Tali eventi comprendono i cambiamenti dell'espressione e dell'attività di recettori accoppiati a proteine G, l'attivazione di protein-chinasi specifiche, le modificazioni dell'espressione genica di fattori di trascrizione e di fattori neurotrofici.

Recenti studi hanno dimostrato che l'eccessiva esposizione a situazioni di stress può rappresentare un fattore scatenante per l'insorgenza della depressione. Circa il 50% dei pazienti affetti da DDM presenta iperattività dell'asse ipotalamo-ipofisi-surrene (HPA) e Lanfuney e coll. (2000) hanno sottolineato rilevanti e reciproche interazioni tra il sistema serotoninergico e la funzionalità dell'asse HPA nella depressione. Inoltre lo stress cronico può indurre una riduzione della sintesi di fattori neurotrofici: tali proteine sono importanti per il corretto funzionamento neuronale in quanto non solo hanno un ruolo fondamentale durante lo sviluppo del SNC, ma sono determinanti nei fenomeni di plasticità sinaptica.

E' stato infatti suggerito che i disturbi dell'umore sono associati ad alterazioni della plasticità neuronale (Manij e coll. 2000; Manij e coll. 2000) e che i pathways di segnale coinvolti nella sopravvivenza e nella morte cellulare siano i bersagli a lungo termine dell'azione farmacologica. Gli antidepressivi e il litio, un farmaco stabilizzante dell'umore, modulano indirettamente un certo numero di fattori coinvolti nei meccanismi di sopravvivenza e morte cellulare, tra cui la proteina CREB (Cyclic AMP Responsive Element Binding Protein) e la proteina BDNF (Brain-derived Neurotropic Factor) (Duman e coll. 1997).

Duman e coll. (1997) hanno inoltre dimostrato che farmaci antidepressivi, anche molto diversi dal punto di vista chimico, possiedono in comune la capacità di aumentare l'espressione di proteine ad azione neuroprotettiva.

Il potenziamento sinaptico della trasmissione monoaminergica indotto dagli antidepressivi attraverso l'inibizione delle MAO o il blocco della ricaptazione o la down-regolazione dell'autorecettore presinaptico/somatodendritico, determinerebbe quindi una maggiore attivazione dei recettori post-sinaptici, accoppiati a meccanismi di trasduzione del segnale. La ripetuta attivazione di queste cascate intracellulari porterebbe alla attivazione di fattori di trascrizione che, a loro volta, sarebbero in grado di controllare l'espressione di geni coinvolti nella sopravvivenza delle cellule nervose.

Duman e coll. (1997) in seguito a terapia cronica con antidepressivi hanno osservato nell'ippocampo di ratto un aumento della concentrazione del mRNA che codifica per il fattore di trascrizione CREB e un aumento della concentrazione della proteina stessa. Sulla base di tale evidenza hanno ipotizzato che CREB sia responsabile dell'attivazione dei geni che controllano l'espressione del BDNF e del suo recettore Trk.

Il BDNF è una neurotrofina appartenente ad una famiglia di fattori di crescita deputati al controllo di numerose attività neuronali, quali i meccanismi di differenziazione durante lo sviluppo e quelli di sopravvivenza nel cervello adulto.

In accordo con l'ipotesi sopra formulata, gli autori hanno osservato un aumento dei livelli del BDNF e del suo mRNA nell'ippocampo dei ratti trattati in modo cronico con un' ampia varietà di antidepressivi.

A conferma di ciò, è stato dimostrato che alcuni pazienti depressi presentano livelli sierici di BDNF più bassi rispetto a soggetti sani di controllo (Smith e coll. 1995). Gli stessi autori hanno dimostrato che lo stress può ridurre l'espressione del BDNF nell'ippocampo del ratto e che tale effetto può essere contrastato dal trattamento cronico (ma non acuto) con farmaci antidepressivi. Infine, Siuciak e coll. (1997) hanno riportato che l'infusione intracerebrale di BDNF ha effetti antidepressivo-simili.

Sulla base di queste e numerose altre evidenze sperimentali oggi si ritiene che i disturbi affettivi possano essere provocati da fattori individuali (genetici) e da fattori legati all'ambiente e alle condizioni di vita, che interverrebbero durante lo sviluppo o nel corso della vita adulta, contribuendo in misura diversa al deterioramento della capacità omeostatica delle cellule e alla progressiva perdita della plasticità neuronale. Le neurotrofine, tra cui il BDNF, favoriscono la sopravvivenza della cellula attivando diverse vie di propagazione del segnale, tra cui il pathway della PI-3-Kinasi e quello della MAP-Kinasi. La cascata della MAP-Kinasi prevede la fosforilazione di intermedi quali Ras, Raf, MEK ed ERK. Uno dei bersagli di ERK è RSK che può influenzare la sopravvivenza cellulare in due modi: 1) inattivando mediante fosforilazione il fattore pro-apoptotico BAD, aumentando così la trascrizione del gene anti-apoptotico Bcl2 e 2) fosforilando CREB, che a sua volta aumenta la trascrizione del gene BDNF.

Oltre che dalla via della MAP-Kinasi (Ghosh e coll. 1994), CREB può essere attivato mediante fosforilazione da parte della PKA, attivata dei recettori β-adrenergici (Roseboom e Klein, 1995) e della PKC, attivata dai recettori α1-adrenergici e 5-HT2 serotoninergici (Duman, 1998).

La ricerca preclinica ha chiaramente evidenziato che i farmaci antidepressivi sono in grado di promuovere la fosforilazione di CREB e, di conseguenza, aumentare l' espressione del BDNF.

Dati post-mortem evidenziano che pazienti depressi non trattati farmacologicamente presentano livelli di CREB inferiori nella corteccia frontale e nell'ippocampo rispetto ai soggetti sani.

Uno dei principali meccanismi attraverso cui il BDNF promuove la sopravvivenza della cellula è l'aumento dell'espressione delle principali proteine anti-apoptotiche (quindi citoprotettive), Bcl-2 e Bcl-X, rispetto a BAD e BAX, altri membri pro-apoptotici della famiglia Bcl. E' noto che il mantenimento dell'equilibrio tra i livelli dei fattori pro- ed anti-apoptotici può influenzare la sopravvivenza delle cellule neuronali nel SNC.

Bcl-2 controlla il processo di morte cellulare programmata attraverso la regolazione del rilascio di Ca++ e del Citocromo C dai mitocondri. Il Citocromo C nel citoplasma della cellula è in grado di sequestrare la preforma degli enzimi induttori di morte, le caspasi, interrompendo il segnale intracellulare di morte.

Il litio e il valproato, due farmaci stabilizzanti dell'umore, hanno effetti neuroprotettivi in quanto aumentano l'espressione di Bcl-2 e inibiscono la kinasi GSK-3β. Il valproato sembra anche in grado di attivare il pathway della MAP-Kinasi (Manij e coll. 2000; Manij e coll. 2000).

Recenti studi hanno rivelato che gli antidepressivi aumentano l'espressione non solo di CREB fosforilato (pCREB), ma anche dei geni che codificano per CAM-L1, proteina L1 di adesione cellulare, e per la laminina (Laifenfeld e coll. 2002a, Laifenfeld e coll. 2002b; Laifenfeld e coll. 2005). Tutte queste molecole sembrano coinvolte nei processi di crescita, sopravvivenza e differenziamento neuronale (Hall e coll. 1997, Hall e coll. 2000; Kamiguchi e Lemmon, 1997; Karin e Hunter, 1995; Luthl e coll. 1994). Sembra che per attivare i fenomeni di plasticità sia necessario che CREB leghi Barx2 e che tale legame influenzi la trascrizione di CAM-L1 (Crossin e Krushel, 2000); a ciò pare che debba seguire il legame di CAM-L1 alla Laminina (Hall e coll. 1997, Hall e coll. 2000).

Figura 1. Ipotesi sulla neuropatogenesi della depressione

La plasticità sinaptica è un meccanismo dinamico che consente alle reti neuronali di adattare e modellare la propria struttura e e le proprie funzioni in risposta agli stimoli interni ed esterni (Zilles e coll. 1992).

Questa capacità di modificare l'efficacia della connettività sinaptica è una caratteristica determinante per l'adattamento e la sopravvivenza degli organismi viventi. Nel cervello, in particolare nel sistema limbico e nella corteccia frontale, tali modificazioni della connettività sono alla base dell'apprendimento e della memoria, ma determinano anche le risposte allo stress e i sintomi cognitivi, l'ansia e i disturbi della sfera emozionale che accompagnano la depressione (Le Doux, 1996; Sweatt, 2001).

Alcuni studi in vivo hanno mostrato che la terapia elettroconvulsiva (ECS) aumenta la plasticità neuronale nel giro dentato dell'ippocampo del piccolo roditore (Steward and Reid, 1993; Reid and Steward, 1997). Gli stessi autori hanno riportato che anche la somministrazione di fluoxetina, un antidepressivo che blocca in modo selettivo la ricaptazione della 5-HT, provoca lo stesso effetto. Queste evidenze sono coerenti con le osservazioni cliniche riguardanti l'efficacia della ECT nel trattamento del DDM (Steward and Reid, 1993; Steward and Reid, 2000; Reid and Steward, 1997; Reid and Steward, 2001).

Petrie e coll. (2000) hanno suggerito che la capacità di potenziare la plasticità sinaptica (e non solo la capacità di favorire la sopravvivenza neuronale) sia la proprietà che determina l'efficacia terapeutica dei farmaci antidepressivi.

RUOLO DELLO STRESS NEI DISTURBI AFFETTIVI

Numerose evidenze hanno confermato che, in soggetti predisposti, lo stress è associato al rischio di insorgenza di disturbi dell'umore.

L'aumento dei livelli endogeni di glucocorticoidi che si verifica in seguito a stress acuto ha effetti importanti sull'ippocampo e sui meccanismi che regolano la plasticità neuronale. Nell'ippocampo sono presenti recettori per i corticosteroidi, sia di tipo I ad alta affinità, sia di tipo II a bassa affinità.

L'attivazione di uno o l'altro di questi sottotipi recettoriali da parte del corticosterone upregola o downregola la connettività sinaptica in modo concentrazione-dipendente (Pavlides e coll. 1995). Alti livelli di corticosterone, il principale ormone dello stress nei roditori, riducono la capacità dei neuroni ippocampali di creare nuovi contatti sinaptici. Al contrario, bassi livelli di corticosterone, che attivano il recettore di tipo I, aumentano la plasticità sinaptica. Agonisti selettivi per il recettore di tipo II mimano gli effetti di alti livelli di corticosterone, mentre composti antagonisti del recettore di tipo II contrastano le modificazioni indotte dallo stress sulla plasticità sinaptica (Xu e coll, 1998).

Gli effetti dei corticosteroidi potrebbero essere legati all'attività del BDNF, in quanto alti livelli di corticosterone downregolano la trascrizione del gene BDNF e riducono i livelli della neurotrofina nell'ippocampo (Schaaf e coll, 1998).

La rimozione delle ghiandole surrenali previene la diminuzione stress-indotta della plasticità neuronale, ma il fenomeno è aumentato in seguito a somministrazione di glucocorticoidi.

Studi sulla relazione tra stress e plasticità neuronale hanno consolidato l'opinione che eventi avversi ed esperienze negative sperimentati nell'età dello sviluppo possano accrescere la vulnerabilità del soggetto e favorire la comparsa di disturbi dell'umore in età più avanzata. Kehoe e coll. (1995) hanno dimostrato nel giro dentato dell'ippocampo di ratti neonati, che hanno sperimentato episodi ripetuti di breve separazione dalla madre (un'ora al giorno per otto giorni consecutivi), un' aumento dell'induzione e della durata dell'LTP (Long-Term Potentiation); dopo tre settimane compaiono evidenti modificazioni della plasticità neuronale con effetti maggiori nel maschio rispetto alla femmina.

Alcuni autori hanno infine osservato che l'esposizione ad alcuni tipi di stress nell'infanzia porta ad alterazioni persistenti dell'asse HPA, dei sistemi serotoninergico e noradrenergico centrali e del sistema nervoso simpatico, modificazioni che possono determinare una più accentuata vulnerabilità soggettiva nei confronti di stress conseguenti.

TEST PRECLINICI PER LA VALUTAZIONE DELL'ATTIVITA' DEGLI ANTIDEPRESSIVI

I modelli animali costituiscono strumenti indispensabili per la ricerca in campo biologico in quanto consentono di riprodurre in organismi più semplici le caratteristiche essenziali di alcune patologie umane e, di conseguenza, di individuare i possibili bersagli per la messa a punto di nuove strategie terapeutiche (Suomi, 1982; McKinney, 1988).

I modelli animali dei disturbi psichiatrici possono essere definiti operativamente come "insoliti stati comportamentali" che possono essere contrastati in modo specifico dalla stessa terapia farmacologica che annulla i sintomi della malattia nell'uomo (Petty e Sherman, 1981). Un modello animale di disturbo psichiatrico idealmente dovrebbe essere semplice, riproducibile, e presentare analogie con il disturbo umano nella sintomatologia, nell'eziopatogenesi e nella risposta al trattamento (Murphy, 1977; Crawley e coll. 1984; Crawley e coll. 1985; Willner, 1984). La depressione, come molte patologie psichiatriche, coinvolge processi cognitivi, emozionali e motivazionali difficilmente riproducibili nell'animale da laboratorio. Allo stato attuale infatti non esistono modelli animali di depressione che soddisfano in pieno i requisiti essenziali precedentemente esposti. Il problema diventa più complesso se si prende in considerazione il BD, nel quale si alternano episodi ricorrenti di mania e depressione. Il limite principale per la messa a punto di un modello animale di BD è rappresentato proprio dall' impossibilità, al momento, di riprodurre la ciclicità dell'umore.

Prendendo in considerazione il DDM, il numero e l'ampia varietà di sintomi che caratterizzano il disturbo rappresentano l'ostacolo maggiore alla realizzazione di un modello preclinico. Inoltre, alcuni sintomi del DDM, come l' ideazione suicidaria, la ridotta autostima e i ricorrenti sensi di colpa, non possono essere ricreati negli animali.

Nonostante le evidenti difficoltà, negli ultimi decenni sono stati sviluppati modelli preclinici di depressione che riproducono in modo convincente, sia nel ratto che nel topo, alcuni sintomi cardine della depressione umana. L'uso di tali modelli animali può fornire importanti informazioni sui meccanismi fisiopatologici della depressione e, allo stesso tempo, è utile per individuare i possibili bersagli per nuovi farmaci antidepressivi e per valutarne l'efficacia terapeutica prima della sperimentazione sull'uomo.

Circa trenta anni fa McKinney e Bunney hanno suggerito i requisiti essenziali per un buon modello preclinico di depressione:

il modello deve essere "ragionevolmente analogo" alla patologia umana per ciò che concerne la sintomatologia;

il modello deve produrre nella specie animale utilizzata modificazioni del comportamento che possano essere oggettivamente misurate e monitorate;

le modificazioni comportamentali dovrebbero essere prevenute e contrastate dalle stesse strategie terapeutiche efficaci nel trattamento della depressione umana (il modello cioè deve rispondere adeguatamente ai farmaci antidepressivi);

il modello animale deve essere facilmente riproducibile.

In tempi più recenti, Willner e coll. (1991) hanno elaborato ulteriormente queste problematiche, fissando i criteri di validità di un modello animale di depressione:

la "validità predittiva" o "isomorfismo farmacologico" è definita come la capacità del modello animale di rispondere ai farmaci antidepressivi, in altre parole si deve poter verificare la corrispondenza tra gli effetti dei farmaci nel modello e in clinica;

la "validità d'aspetto" è la corrispondenza tra le modificazioni comportamentali prodotte nel modello animale e i sintomi della patologia umana;

la "validità del costrutto" è la corrispondenza tra il modello e la patologia umana alla luce delle attuali conoscenze sull'eziopatofisiologia della depressione.

Molti modelli preclinici di depressione attualmente disponibili hanno una buona validità predittiva, con relativamente pochi falsi positivi e falsi negativi, pochi modelli rispecchiano più di due criteri di validità e, infine, soltanto alcuni modelli sono coerenti con la cronicità della depressione umana (Willner 1984, Willner 1990).

E' chiaro che la validità di ogni modello preclinico, secondo i criteri precedentemente citati, deve essere valutata con estrema cautela prima di estrapolare e trasferire i risultati ottenuti dall'animale all'uomo (Yadid, 1998; Cryan, Markou e Lucki, 2002).

I modelli di depressione oggi in uso sono stati sviluppati utilizzando le conseguenze dello stress, somministrato durante lo sviluppo o in età adulta, le modificazioni indotte da intervento chirurgico/trattamento farmacologico o la selezione fenotipica.

ASPORTAZIONE DEI BULBI OLFATTIVI

La rimozione bilaterale dei bulbi olfattivi nel ratto, nel topo e nel criceto causa una complessa varietà di alterazioni comportamentali, neurochimiche, endocrine e del sistema immunitario, molte delle quali correlabili con i sintomi osservati nel DDM (Kelly e coll. 1997).

La più rilevante modificazione del comportamento provocata dalla bulbectomia olfattiva è rappresentata da un aumento dell'attività locomotoria, normalizzato dal trattamento cronico, ma non acuto, con farmaci antidepressivi, (Kelly e coll. 1997; Cryan e coll. 1998).

Recenti studi hanno suggerito che l'iperattività motoria sia correlabile ad una esaltazione del comportamento difensivo (Stock e coll. 2001) o ad alterazioni del comportamento avversivo (Primeaux e Holmes, 1999).

Mar e coll. (2000) hanno anche riportato che il trattamento con farmaci antidepressivi aumenta nell'animale bulbectomizzato la capacità di abituarsi alla novità e di adattarsi a stimoli ambientali di varia natura e che tali effetti non sono secondari all'anosmia (perdita dell'odorato). Altri autori hanno focalizzato l'attenzione sulle alterazioni neurochimiche e molecolari che sottendono le modificazioni comportamentali sensibili al trattamento con antidepressivi.

Sono associate alla bulbectomia olfattiva modificazioni della funzionalità dei sistemi serotoninergico, colinergico, GABAergico, noradrenergico, glutamatergico e un aumento dell'escrezione notturna del corticosterone, soppressa dal dexametazone (Kelly e coll. 1997).

Connor e coll. (1999) sostengono invece che l'animale bulbectomizzato rappresenti un modello di depressione caratterizzata da ipofunzionalità serotoninergica, in quanto sono state osservate modificazioni dell'innervazione da parte della 5-HT nella corteccia frontale (Zhou e coll. 1998) e un aumento delle risposte stress-indotte da parte del sistema serotoninergico (Connor e coll. 1999).

Inoltre è stato dimostrato un aumento del rilascio del glutammato nello striato correlabile con l'iperattività motoria dell'animale, il quale potrebbe avere un ruolo modulatorio nella risposta agli antidepressivi (Ho e coll. 2000). Altri autori hanno rilevato aumenti della concentrazione di alcuni neuropeptidi, come il CRH, il TRH, la somatostatina (Bissette, 2001) e il neuropeptide Y (Holmes e coll. 1998), che potrebbero anch'essi giocare un ruolo nella comparsa delle modificazioni del comportamento peculiari del modello.

Immagini di risonanza magnetica hanno mostrato alterazioni d'intensità del segnale nella corteccia, nell'ippocampo, nel caudato e nell'amigdala negli animali sottoposti ad asportazione dei bulbi olfattivi rispetto ad animali di controllo (Wrynn e coll. 2000). Negli animali bulbectomizzati è evidente anche un allargamenti dei ventricoli (Wrynn e coll. 2000), fenomeno che gli autori hanno correlato con i cambiamenti morfologici osservati in alcuni pazienti depressi.

TEST DEL NUOTO FORZATO O TEST DI PORSOLT

Fu sviluppato da Porsolt e coll. nel ratto (Porsolt, 1997) e, successivamente, nel topo (Porsolt, 2000). E' il modello preclinico più utilizzato per valutare l'efficacia dei farmaci antidepressivi. La larga diffusione di tale modello è dovuta alla buona validità predittiva e alla relativa semplicità del protocollo (Borsini e Mell, 1998). Il test si basa sull'osservazione che l'animale, se posto all'interno di un cilindro pieno d'acqua dal quale non può uscire, inizialmente si muove concitatamente tentando di fuggire ma, dopo un certo tempo, vista l'impossibilità di fuga, tende a restare immobile, galleggiando sul pelo dell'acqua. Se, dopo 24 ore, l'animale viene posto nuovamente nel cilindro, assume una postura immobile per quasi tutta la durata del test. Si ritiene che l'immobilità rifletta la rinuncia da parte dell'animale a mantenere un comportamento orientato alla fuga (Lucki, 1997): l'animale infatti sviluppa un comportamento passivo mirato ad evitare lo stress derivante dalla ricerca di una via di salvezza (Lucki, 1997). Se tra le due sessioni sperimentali del test di Porsolt l'animale viene trattato in acuto con farmaci antidepressivi, il tempo di immobilità si riduce. Quasi tutti i farmaci antidepressivi oggi in uso riducono in modo significativo rispetto ai controlli il tempo di immobilità dell'animale nel corso della seconda sessione e ne aumentano di conseguenza il comportamento orientato alla fuga.

La debolezza di questo modello preclinico di depressione risiede nella constatazione che l'efficacia antidepressiva compare dopo somministrazione acuta (quindi con un andamento temporale diverso da quello clinico) e nella necessità di somministrare dosi ben più elevate di quelle utilizzate in terapia umana, per esempio per valutare l'efficacia degli inibitori selettivi della ricaptazione della 5-HT (SSRIs) (Lucki, 1997).

Nel tentativo di porre rimedio a queste limitazioni del test di Porsolt tradizionale, sono state apportate alcune modifiche al protocollo sperimentale (Lucki, 1997). Tali variazioni comprendono l'aumento della profondità dell'acqua nel cilindro (30 cm contro 15-18 cm) e la valutazione di nuovi parametri comportamentali. Oltre al tempo di immobilità (immobility), viene misurato il tempo speso dall'animale per tentare di arrampicarsi sulle pareti del cilindro (climbing) e il tempo di nuoto con movimento orizzontale (swimming) (Lucki, 1997).

Il test di Porsolt così modificato ha una maggiore validità predittiva e consente di acquisire utili informazioni sul possibile meccanismo d'azione del farmaco in esame (Lucki, 1997; Cryan e Lucki, 2000). Infatti, i farmaci antidepressivi con meccanismo noradrenergico, come la reboxetina, causano una diminuzione del tempo d'immobilità dell'animale e un aumento del tempo di climbing, mentre gli antidepressivi con meccanismo serotoninergico riducono il tempo d'immobilità ma aumentano il tempo di swimming.

LEARNED HELPLESSNESS

Il modello di learned helplessness, ideato da Seligman e Beagley (1975) nella prima metà degli anni '70, è concettualmente simile al test di Porsolt e rappresenta uno tra i più utilizzati modelli preclinici di depressione.

Si basa sull'osservazione che gli animali, sottoposti ad una serie di eventi stressanti ai quali non possono sottrarsi, sviluppano un deficit nel comportamento di evitamento. Il protocollo è strutturato in due fasi successive. Nella prima fase l'animale viene sottoposto ad una serie di stimoli dolorosi (scossa nelle zampe attraverso il pavimento elettrificato della gabbia) somministrati in modo casuale per 3-5 giorni consecutivi. La somministrazione di stimoli dolorosi che non è possibile evitare, causa nell'animale uno stato anedonico che si protrae per circa una settimana. Oltre all'anedonia, rilevabile con la diminuzione della preferenza al saccarosio, negli animali sottoposti alla fase di pretrattamento compaiono perdita di peso, iperattività motoria, disturbi del sonno e alterazioni dell'asse HPA (Weiss, 1968, Wagner e coll. 1977). Quando nella seconda fase l'animale viene sottoposto ad un test di evitamento passivo, la performance risulta significativamente diversa rispetto agli animali di controllo, in quanto, negli animali stressati, aumenta la frequenza di scosse non evitate (Rosellini e De Cola, 1981). I farmaci antidepressivi (TCA, SSRI, iMAO, mianserina) (Weiss e coll. 1998) sono efficaci nel migliorare la performance negli animali stressati; anche un trattamento non farmacologico come uno shock elettroconvulsivo è efficace in questo modello preclinico di depressione.

STRESS CRONICO VARIATO

Il modello animale di stress cronico variato (CMS), ideato da Katz (1982) e perfezionato successivamente da Willner (1984, 1997), è basato sull' induzione di uno stato anedonico nel ratto (Willner e coll. 1987; Willner e coll. 1992) o nel topo (Montleon e coll. 1994), mediante l'esposizione a blandi stimoli stressogeni di natura diversa, somministrati in modo non prevedibile per un periodo di alcune settimane.

L'anedonia è misurata con tecniche non invasive quali, per esempio, il progressivo calo della naturale preferenza dell'animale al saccarosio.

Gli stimoli previsti dal protocollo originale sono la privazione di cibo o di acqua, l'inversione del ciclo luce-buio, l'inclinazione o lo scuotimento della gabbia, l'affollamento della gabbia, il nuoto forzato in acqua fredda, la somministrazione di scosse elettriche nelle zampe e lo stress da costrizione. Willner e coll. (1987) hanno successivamente modificato il protocollo, escludendo gli stimoli troppo intensi ed introducendo invece stimoli stressogeni più blandi per un tempo più lungo. In queste condizioni lo stato anedonico si mantiene per alcune settimane, riproducendo l'aspetto di cronicità della patologia umana.

Oltre alla diminuzione delle risposte agli stimoli appetitivi, il CMS provoca altri sintomi paragonabili a quelli della depressione umana. Sono stati osservati, da numerosi ricercatori, diminuzione del comportamento sessuale e del comportamento esplorativo, aggressività e rallentamentio dell'attività motoria (D'Aquila e coll. 1994). Gli animali rispondono allo stress cronico anche con cambiamenti nei ritmi circadiani (Gorka e coll. 1996) e con disturbi del sonno (Moreau e coll. 1995; Cheeta e coll. 1997). Inoltre mostrano un'aumentata attività dell'asse HPA, ipertrofia cortico-surrenale (Muscat e Willner, 1992) e ipersecrezione di corticosterone (Ayensu e coll. 1995). Sono state descritte anche alterazioni del sistema immunitario con aumento dei livelli di proteine del sistema del complemento e di proteine caratteristiche della fase acuta dell'infiammazione (Ayensu e coll. 1995), diminuzioni del peso del timo, minore attività dei linfociti natural killer e della reattività agli stimoli mitogeni da parte dei linfociti T (Kubera e coll. 1994, Kubera e coll. 1995).

L'anedonia, definita come la diminuzione della capacità di sperimentare piacere (Fawcett e coll. 1983), nel modello CMS è rappresentata soprattutto da una diminuzione della sensibilità alla ricompensa. Nel protocollo sperimentale CMS lo stato anedonico viene misurato in base alla diminuzione della preferenza nei confronti di una soluzione di saccarosio (1-2%), normalmente molto gradita all'animale.

Il modello, dunque, è basato su due presupposti, vale a dire che la soluzione di saccarosio rappresenti una valida misura della soglia di autogratificazione e che questa sia aumentata, e non diminuita, dallo stress cronico.

Numerose evidenze sperimentali hanno dimostrato che durante il CMS non si misura una diminuzione del consumo di acqua pura (Muscat e Willner, 1992), dunque il decremento dell'assunzione della bevanda al saccarosio non può essere spiegato semplicemente con una variazione del consumo di liquidi. Inoltre le calorie contenute nel saccarosio sono risultate ininfluenti, in quanto effetti simili sono stati osservati in animali che consumano soluzioni di saccarosio ipocaloriche (Willner e coll. 1987; Ayensu e coll. 1995), e una diminuzione del consumo di soluzione al saccarosio è stata notata anche gli animali preventivamente a digiuno (Muscat e Willner, 1992). Anche il consumo di cibo non subisce variazioni durante il CMS, mentre sono modificate le proprietà gratificanti dell'alimento, come indicato dallo scarso interesse per il luogo di consumo del pasto (Papp e coll. 1991; Muscat e coll. 1992; Willner e coll. 1994) e da un'accelerazione dell'ingestione dello stesso (Sampson e coll. 1991). Infine, l'osservazione che il CMS induca anedonia non è basata esclusivamente sui dati sperimentali che misurano la preferenza al saccarosio, ma è supportata anche dalla verifica che il CMS causa un aumento della soglia di autostimolazione cerebrale. Lo stress cronico infatti causa un aumento della corrente-soglia necessaria per mantenere l'autostimolazione intracranica sugli elettrodi impiantati nell'area tegmentale ventrale del mesencefalo (Moreau e coll. 1992; Moreau e coll. 1993; Moreau e coll. 1994a; Moreau e coll. 1994b; Moreau e coll. 1995).

Come nell'uomo, la terapia cronica con farmaci antidepressivi è in grado di annullare i sintomi provocati dal CMS con una latenza di 3-4 settimane.

Gli antidepressivi considerati efficaci per il trattamento dell'anedonia provocata da CMS sono: i triciclici imipramina, desmipramina, amitriptilina (Willner e coll. 1987; Muscat e coll. 1990; Papp e coll. 1996; Sluzewska e Szczawinska, 1996a; Valverde e coll. 1997), gli SSRI fluoxetina, fluvoxamina, citalopram (Muscat e coll. 1992; Przegalinski e coll. 1995; Marona-Lewicka e Nichols, 1996; Sluzewska e Szczawinska, 1996a, Sluzewska e Szczawinska, 1996b), la maprotilina uno specifico inibitore della ricaptazione del Na (Muscat e coll. 1992), il moclobemide un iMAO (Moreau e coll. 1993), il brofaromine (Papp e coll. 1996) e la mianserina un antidepressivo atipico (Cheeta e coll. 1994; Moreau e coll. 1994a). In tutti gli studi, i sopra citati farmaci, sono efficaci a dosi moderate (in molti casi comprese nel range terapeutico) e, come in terapia umana, una completa risposta al trattamento richiede tipicamente 3-5 settimane. Altri farmaci, meno convenzionali, ma ugualmente efficaci nel modello CMS includono gli stabilizzanti dell'umore litio (Sluzewska e Szczawinska, 1996a) e carbamazepina (Sluzewsaka e Nowakowska, 1994), il farmaco ansiolitico buspirone (Przegalinski e coll. 1995; Papp e coll. 1996) e il ketoconazolo (Sluzewska e Nowakowska, 1994).

Anche lo shock elettroconvulsivo è efficace dopo una singola settimana di trattamento (Moreau e coll. 1995).

La mepiramina, un antistaminico, e l'atropina, un anticolinergico, sembrerebbero essere dei falsi positivi (Papp e coll. 1996), mentre l'ipsapirone, un agonista parziale 5-HT1a, diversamente dal buspirone, è inattivo nel modello CMS e ciò fa presupporre un caso di falso negativo.

Il trattamento con agonisti del recettore D2 dopaminergico è efficace nel contrastare l'anedonia indotta da CMS, mentre il trattamento con antagonisti D2 agisce in modo opposto (Muscat e coll. 1992; Papp e coll. 1993).

Alcuni studi hanno confermato che il modello CMS causa modificazioni, annullate dal trattamento con antidepressivi, della funzionalità di alcuni sistemi recettoriali. Per esempio, è stata dimostrata una diminuzione dei recettori D2/D3 nel nucleo accumbens e un aumento dei recettori 5-HT2 e ß-adrenergici nella corteccia cerebrale. Il CMS inoltre aumenta i recettori corticali 5-HT1A, ma questo effetto non è annullato dal trattamento cronico con antidepressivi (Papp e coll. 1994a, Papp e coll. 1994b; Willner e Papp, 1997).

Utilizzando tecniche atte a misurare in vivo il release di neurotrasmettitori, è stata dimostrata negli animali esposti al CMS, una diminuzione del rilascio di DA nel nucleo accumbens e nella corteccia prefrontale (Smadja, 1996).

Queste osservazioni nel complesso indicano che il modello CMS, oltre ad essere dotato di buon isomorfismo farmacologico, può fornire utili indicazioni sulla patogenesi della depressione.

RATTI CON FENOTIPO SwLo E SwHi

Questo modello preclinico prevede la scelta di un fenotipo swim low-active (SwLo), cioè la scelta di animali che nel test di Porsolt presentano un tempo di immobilità superiore alla media. In base alla risposta comportamentale nel test del nuoto forzato, i ratti sono stati divisi in due gruppi a seconda della innata tendenza all'immobilità e, successivamente, incrociando più volte i ratti selezionati in funzione delle caratteristiche fenotipiche, si sono ottenuti due ceppi selezionati di ratti, una con elevato (swim low-active o SwLo) e l'altro con basso tempo di immobilità (swim high-active o SwHi).

L' osservazione comportamentale dei ratti SwLo e SwHi ha dimostrato che i ratti SwLo mostrano un comportamento passivo (Weiss, 1998; West e coll. 1999). Essi presentano una diminuzione della funzionalità dopaminergica e l'infusione di amfetamina nel cervello dei ratti SwLo causa soltanto un lieve aumento dell'attività motoria (West e coll. 1999).

Inoltre, la somministrazione di imipramina, venlafaxina e desipramina, fenelzina e bupropione, ma non di fluoxetina, sertralina e amitriptilina, provoca un aumento del comportamento attivo nei ratti SwLo sottoposti al test di nuoto forzato.

In accordo con questa risultati, si ritiene che il modello SwLo rappresenti un modello preclinico di depressione atipica (West e Weiss, 1998).

GLI ANTIPSICOTICI ATIPICI NEL TRATTAMENTO DEI DISTURBI AFFETTIVI

Gli antipsicotici tipici (APT) sono stati utilizzati con successo per oltre 40 anni nel trattamento di pazienti bipolari psicotici o in stato di agitazione psicomotoria. Tali composti sono risultati essenziali nella risoluzione dei casi più gravi, ad elevato rischio di mortalità, e il loro impiego ha reso possibile la dimissione e la conseguente riabilitazione sociale dei pazienti "psicotici cronici" istituzionalizzati. Bisogna tuttavia ricordare che, sebbene questi farmaci posseggano una notevole efficacia e rapidità d'azione nel controllo della sintomatologia psicotica e degli stati più gravi di agitazione psicomotoria, non sembrano avere un'efficacia paragonabile a quella degli stabilizzanti dell'umore nella profilassi delle ricorrenze del BD, in particolare di quelle depressive. Tuttavia, nonostante l'utilità degli APT nella terapia di mantenimento del disordine bipolare non sia mai stata dimostrata, né indagata sistematicamente, il loro impiego è estremamente diffuso, sia in monoterapia, che in combinazione con antidepressivi e stabilizzanti dell'umore. Ciò malgrado sia ampiamente documentato come le terapie combinate possano aumentare la frequenza e la gravità delle reazioni avverse, a causa di un sinergismo reciproco nell'induzione di effetti collaterali. Le linee guida proposte dalle varie organizzazioni internazionali (APA, WHO, ecc.) suggeriscono all'unanimità che gli APT dovrebbero essere utilizzati solo durante le fasi acute di malattia, sia per il rischio di reazioni avverse, che per l'impatto negativo che il loro impiego protratto potrebbe avere sul decorso a lungo termine del BD. Tuttavia, contrariamente a quanto raccomandano gli esperti, molti pazienti bipolari assumono APT, sia in maniera intermittente che continuativa, per lunghi periodi di tempo. Alcuni studi hanno evidenziato (Sernyak e coll. 1997; Zarate e coll. 2000 a) come una percentuale di pazienti bipolari compresa tra il 24 e il 95% sia trattata con APT per tempi prolungati. Sono state identificate alcune variabili in grado di predire quali, fra i pazienti bipolari, vanno incontro più spesso a trattamenti a lungo termine con APT; tra tali variabili ricordiamo il sesso maschile, l'assenza di compliance ai trattamenti farmacologici nel mese precedente il ricovero, la gravità dei sintomi maniacali (Keck e coll. 1996). L'introduzione nella pratica clinica dei cosiddetti antipsicotici "atipici" (APA), che si caratterizzano per un migliore profilo sul piano degli effetti collaterali, soprattutto di tipo extrapiramidale, ha rappresentato una svolta anche nel trattamento dei disturbi dell'umore. Se, inizialmente, l'uso degli APA era limitato alle psicosi dello spettro schizofrenico, la disponibilità di questi farmaci ha portato ad un allargamento progressivo del loro impiego ad altri ambiti nosografici, dove tradizionalmente, a torto o a ragione, gli APT sono stati utilizzati largamente. In particolare i disturbi dell'umore, per la loro importanza sul piano epidemiologico e clinico, hanno rappresentato il settore dove, forse ancor più che per i disturbi dello spettro schizofrenico, i neurolettici atipici hanno aperto nuove prospettive terapeutiche per il trattamento acuto e cronico delle forme resistenti alle terapie tradizionali. Le peculiari caratteristiche farmacocinetiche e farmacodinamiche, hanno reso olanzapina, risperidone, quetiapina e clozapina (gli antipsicotici atipici oggi in commercio in Italia) strumenti terapeutici di efficacia indubbia, con un profilo di effetti collaterali decisamente favorevole ed una tossicità comportamentale inferiore rispetto agli APT, in particolare nell'impiego a lungo termine.

DEFINIZIONE DI ANTIPSICOTICO ATIPICO

La definizione di antipsicotico "atipico" è stata sviluppata analizzando le caratteristiche della clozapina. L'elemento centrale dell' "atipicità", dal punto di vista clinico, è la proprietà di provocare effetti extrapiramidali in misura minore rispetto ai composti tipici; inoltre, fra le altre caratteristiche che gli APA dovrebbero possedere, bisogna ricordare la non induzione di iperprolattinemia, l'efficacia sui sintomi negativi della schizofrenia, così come sulle forme psicotiche resistenti agli APT. Fra tutti i farmaci definiti "atipici" solamente la clozapina sembra possedere tutte queste caratteristiche, mentre sia l'olanzapina che la quetiapina, pur avvicinandosi molto a questo profilo, ne presenterebbero solamente alcune. Il risperidone non sembra possedere molte delle caratteristiche di atipicità e per diversi aspetti non è dissimile dai farmaci definiti tipici. Anche per questi ultimi, infatti, la comparsa di effetti extrapiramidali è dose dipendente.

BASI FARMACOLOGICHE DELL'ATIPICITÀ

L'aloperidolo, prototipo di neurolettico "tipico", è dotato di un'elevata affinità per i recettori dopaminergici D2 mentre la clozapina, capostipite dei cosiddetti "atipici", mostra una bassa affinità per il medesimo sottotipo recettoriale. È opinione ampiamente condivisa che risposta clinica e comparsa di effetti collaterali risultino direttamente correlati alla percentuale di occupazione recettoriale D2 (Farde e coll. 1992). A tal proposito, Kapur e coll. (2000) hanno dimostrato come una saturazione recettoriale D2, pari ad almeno il 65% del totale, sia in grado di produrre una risposta clinica favorevole, così come non comparirebbero effetti collaterali di tipo extrapiramidale se la percentuale di saturazione si mantenesse al di sotto del 78%; inoltre, percentuali di occupazione recettoriale inferiori al 72% causerebbero soltanto incrementi minimi dei livelli di prolattina (Daskalakis e coll. 1998). Tali osservazioni sarebbero valevoli per tutti gli antipsicotici, tipici ed atipici; le differenze fra APT ed APA così come quelle, reciproche, fra le molecole appartenenti a quest'ultima classe farmacologica, sono state correlate alla diversa cinetica del legame recettoriale, come ad esempio alla durata di occupazione del recettore (Kapur e coll. 2000; Kapur e coll. 1998a; Jones e coll. 2000). Per quanto riguarda l'azione sui recettori serotoninergici 5-HT2A, molti "atipici" mostrano una percentuale di occupazione elevata, maggiore di quella per i D2, ma non correlata all'efficacia antipsicotica (Kapur e coll. 1998a; Kapur e coll. 1999; Nyberg e coll. 1997). Questa azione, tuttavia, non sembra rappresentare una condizione necessaria per l' "atipicità", anche in considerazione del fatto che neurolettici incontestabilmente "tipici", come la clorpromazina, possiedono anch'essi tale caratteristica (Kapur e coll. 1997; Martinot e coll. 1998). Inizialmente era stata formulata anche l'ipotesi secondo la quale le caratteristiche "atipiche" di un neurolettico potevano essere ricondotte al ruolo svolto dai recettori di tipo D4; in realtà, poiché l'affinità mostrata per tale sottotipo recettoriale da parte di APT come aloperidolo o clorpromazina, è più elevata rispetto a quella di "atipici" come clozapina od olanzapina (Seeman e coll. 1994), ed in ragione del fatto che farmaci selettivi per i D4 si sono mostrati privi di evidente azione antipsicotica (Bristow e coll. 1997), è da escludere che l'atipicità di un composto sia basata esclusivamente sull'affinità per i recettori D4, essendo tuttavia possibile un coinvolgimento reciproco dei recettori D2 e D4, ciascuno di essi dotato di un differente rapporto di affinità per i diversi principi attivi.

CLOZAPINA

La clozapina (CLO) è stata scoperta in Svizzera nel 1959 dalla Sandoz-Wander. Per le sue caratteristiche stereochimiche tricicliche peculiari, venne studiata inizialmente come antidepressivo, solo successivamente si scoprì che la molecola era dotata di proprietà antipsicotiche (Hippius, 1989). Nel 1975, a causa di alcuni decessi causati dal suo più temibile effetto collaterale, l'agranulocitosi, fu ritirata dal commercio nella maggior parte dei mercati mondiali per poi essere reintrodotta, a partire dagli Stati Uniti, nel 1990, limitatamente al trattamento di pazienti schizofrenici resistenti agli antipsicotici tipici. Studi effettuati negli ultimi quindici anni hanno rilevato l'utilità di CLO non solo nel trattamento delle forme refrattarie di schizofrenia (Kane e coll. 1988; Baldessarini e coll. 1991), ma anche nella fase acuta e nel trattamento profilattico di pazienti con disturbo schizoaffettivo o bipolare, che abbiano risposto in maniera inadeguata e/o che abbiano mal tollerato gli stabilizzanti del tono dell'umore (litio, valproato, carbamazepina) e/o gli antipsicotici tipici (McElroy e coll. 1991; Calabrese e coll. 1996). Due studi in aperto hanno dimostrato l'efficacia di CLO nella mania acuta refrattaria. Nel primo, della durata di 13 settimane, Calabrese e coll. (1996) hanno sperimentato CLO in 25 pazienti maniaci, 10 con diagnosi di disturbo bipolare e 15 di disturbo schizoaffettivo, sottotipo bipolare; il totale del campione aveva precedentemente dimostrato di non rispondere adeguatamente o di non tollerare ATP e/o stabilizzanti del tono dell'umore (litio, valproato, carbamazepina); 18 pazienti (72%) hanno presentato un "marcato miglioramento" alla Young mania Rating Score (YMRS) ed 8 alla Brief Psichiatri Rating Scale (BPRS), inoltre il miglioramento è stato più evidente nei soggetti con disturbo bipolare e non "rapidi-ciclici". L'altra esperienza è quella riportata da Zarate e Tohen (1997, dati non pubblicati) su 22 pazienti con mania acuta refrattaria ai comuni presidi terapeutici (ATP e stabilizzanti classici), i quali erano trattati con CLO in monoterapia (dosaggio medio di 343 mg/die) per 13 settimane. Dei 15 che avevano completato il trattamento, l'87% era da considerare "migliorato" o "molto migliorato". Tre studi retrospettivi hanno preso in considerazione l'efficacia della CLO nella mania disforica e negli stati misti bipolari (Banov e coll. 1994; Battegay e coll. 1977; Suppes e coll. 1992). Il complesso di risultati derivabili da tali osservazioni fornisce una percentuale di risposta alla CLO del 69% (20 pazienti su 29), simile a quanto riportato nei pazienti con DDM. Zarate e coll. (1995a) hanno, infine, condotto una metanalisi che includeva tutti gli studi con CLO (in aperto e retrospettivi) disponibili in letteratura dal 1973 al 1995; dall'analisi dei risultati è emerso, fra l'altro, che i pazienti schizoaffettivi o bipolari in fase maniacale e/o con sintomi psicotici rispondevano meglio alla CLO di quelli schizofrenici (71.2% di 315 pazienti affettivi vs. 61.3% di 692 pazienti schizofrenici, p = .0006); inoltre, i pazienti in fase maniacale o mista-psicotica rispondevano meglio alla CLO di quelli in fase depressiva (72.2% di 79 pazienti maniaci o misti vs. 51.7% di 58 pazienti depressi, p = .001). Esistono in letteratura studi non controllati relativi all'impiego di CLO nella fase acuta e di mantenimento della depressione psicotica resistente. Il complesso dei risultati derivabili da tre studi retrospettivi in aperto (McElroy e coll. 1991; Banov e coll. 1994; Leppig e coll. 1989) rivela che 30 (51.7%) su 58 pazienti unipolari, bipolari e schizoaffettivi trattati, hanno risposto a CLO; nella maggior parte dei casi i trattamenti utilizzati precedentemente avevano fallito. Per quanto riguarda l'impiego di CLO nella profilassi delle ricorrenze maniacali o depressive, le osservazioni disponibili sono ancora scarse. Negli studi riportati in letteratura, emergono tuttavia indicazioni favorevoli al possibile impiego della CLO in monoterapia come stabilizzante dell'umore, in pazienti refrattari e/o intolleranti ai regolatori del tono dell'umore e/o ai neurolettici tipici (Calabrese e coll. 1996; Suppes e coll. 1992; Zarate e coll. 1995b; Suppes e coll. 1996). Suppes e coll. (1992) hanno somministrato CLO in 7 pazienti con mania disforica: tutti i soggetti del campione hanno continuato a mantenere una condizione di sostanziale benessere nel corso dei successivi 4 anni di follow-up. Zarate e coll. (1995b) hanno riportato che 11 pazienti (65%) bipolari o schizoaffettivi su 17 trattati con CLO in monoterapia, non presentavano riacutizzazioni né riospedalizzazioni, per una media di 16 mesi successivi all'episodio maggiore. In una casistica di 22 pazienti (11 bipolari e 11 schizoaffettivi), che continuavano ad assumere CLO per una media di 15 mesi successivi all'episodio maggiore, era necessario incrementare il dosaggio di CLO nel 31.8% dei casi, nel 45.5% era stato aggiunto un antidepressivo a causa della riacutizzazione della sintomatologia depressiva e nel 22.7% si era dovuti ricorrere all'ospedalizzazione (Calabrese e coll. 1996). Non sono disponibili dati sistematici sull'associazione CLO e sali di litio, anche se nella pratica clinica i due composti possono essere utilizzati con relativa sicurezza. Ovviamente può essere presente un certo sinergismo tra gli effetti collaterali ed, in alcuni casi, la posologia dei due farmaci deve essere adattata. I dati concernenti la combinazione di VPA e clozapina sono contrastanti. In uno studio in aperto su 55 pazienti (Kando e coll. 1994) questa combinazione era efficace nell'87% dei casi. I più comuni effetti collaterali erano sedazione, enuresi, nausea ed eccessiva salivazione. Un paziente aveva sviluppato una disfunzione epatica. Il VPA può tuttavia incrementare la concentrazione ematica dei metaboliti della clozapina (Centorrino e coll. 1994) o diminuire la concentrazione di clozapina e dei suoi metaboliti (Longo e coll. 1995). Comunque, dopo diversi mesi di trattamento con questa combinazione, è stato descritto un caso di neurotossicità (Costello e coll. 1995). In uno studio non controllato, Wilson (1995) ha esaminato retrospettivamente cartelle di pazienti che avevano ricevuto clozapina per psicosi refrattarie, concludendo che la somministrazione contemporanea di anticonvulsivanti poteva ridurre l'efficacia della clozapina. I 20 pazienti che avevano ricevuto un trattamento concomitante con anticonvulsivanti, presentavano un decorso clinico peggiore rispetto ai 68 pazienti che non avevano ricevuto anticonvulsivanti. A tutt'oggi l'efficacia e la sicurezza di questa combinazione non è ancora stabilita. La clozapina abbassa la soglia epilettogena, così l'aggiunta di VPA può prevenire le crisi epilettiche. Entrambi i farmaci mostrano proprietà antikindling, ponendo problemi sui rapporti tra epilettogenesi e stabilizzazione dell'umore (Graham e coll. 1993). Sono quindi necessari studi ulteriori. Per quanto riguarda la Carbamazepina (CBZ) l'associazione con CLO viene generalmente controindicata. Entrambi i composti, infatti, producono alterazioni ematologiche con frequenza elevata (Junghan e coll. 1993). Un'altra considerazione importante è che la CBZ abbassa i livelli di CLO in modo maggiore rispetto ad altri neurolettici (Tiihonen e coll. 1995; Raitasuo e coll. 1993). Riguardo la sicurezza, Muller e coll. (1988) hanno descritto un caso di sindrome maligna da neurolettici in un paziente trattato con CBZ e CLO. Quindi tale combinazione non dovrebbe essere considerata sicura.

OLANZAPINA

L' olanzapina (OLZ) è un antipsicotico atipico commercializzato dal 1996 per l'impiego nella schizofrenia. Negli ultimi anni, diversi studi controllati ne hanno confermato l'efficacia nel trattamento delle fasi acute maniacali o miste con o senza sintomi psicotici. Numerose indicazioni preliminari suggeriscono una possibile utilità di OLZ anche come stabilizzante dell'umore, per l'impiego nelle terapie di mantenimento e profilattiche del BD. Sia gli studi naturalistici, che i dati derivati dalle prove cliniche controllate su pazienti con disturbi dell'umore, pubblicati o presentati ai diversi congressi internazionali, sono numericamente maggiori per OLZ che per gli altri APA. Inizialmente, da alcune osservazioni cliniche è emerso come OLZ fosse dotata di proprietà antidepressive nei pazienti psicotici. Baker e coll. (1995) hanno riportato, infatti, che la somministrazione di 10 mg/die di OLZ era in grado di ridurre significativamente il punteggio totalizzato alla HAM-D di una vasta casistica di pazienti schizofrenici. Risultati analoghi sono stati riportati da Tollefson e coll. (1997) nella loro sperimentazione in doppio cieco, controllata verso placebo, condotta su di una popolazione di soggetti schizofrenici o schizoaffettivi. Successivamente in uno studio multicentrico parallelo di confronto in doppio cieco fra OLZ ed aloperidolo, della durata di 6 settimane (Thoen e coll. 1997), venne osservato che i pazienti schizoaffettivi, maniacali e misti, randomizzati ad OLZ, presentavano una riduzione maggiore dei "sintomi maniacali" alla BPRS rispetto a quelli randomizzati ad aloperidolo. Nello stesso studio, gli schizoaffettivi depressi trattati con OLZ totalizzavano punteggi inferiori rispetto al baseline alla Montgomery Ashberg Depression Rating Scale (MADRAS), mentre nei pazienti che avevano ricevuto aloperidolo veniva invece documentato un incremento medio di 6.63 punti rispetto al basale. In seguito a queste osservazioni, sono stati effettuati alcuni studi in aperto su pazienti con disturbi dell'umore resistenti ai trattamenti convenzionali. McElroy e coll. (1998) si sono proposti di valutare la risposta all'OLZ (dosaggio medio 14.1, sd = 7.2) in 14 pazienti con diagnosi di BD tipo I (secondo i criteri del DSM-IV) dimostratisi in precedenza poco responsivi al trattamento con stabilizzanti dell'umore o APT; 8 pazienti (57%) su 14 sono risultati "migliorati" o "molto migliorati" alla CGI-BP. Sharma e Pistor  (1999) hanno riportato i dati relativi al trattamento con OLZ di 9 pazienti ambulatoriali con diagnosi di BD tipo I Episodio Misto secondo i criteri del DSM-IV; in precedenza tali pazienti non avevano risposto in maniera adeguata a stabilizzanti dell'umore, utilizzati in monoterapia oppure in combinazione con APT. Gli autori hanno riportato un miglioramento clinicamente significativo nella totalità dei casi trattati. Bates e coll. (1999) si sono recentemente occupati dell'impiego di OLZ nel trattamento della depressione psicotica; a tale scopo hanno somministrato OLZ in 15 pazienti depressi psicotici; tale popolazione è stata poi messa a confronto retrospettivamente con una popolazione di 15 depressi psicotici trattati con altri neurolettici. Dalle analisi di confronto è emerso che 10 pazienti (67%) su 15 trattati con OLZ risultavano "migliorati" o "molto migliorati" a confronto dei 4 (27%) su 15 cui erano stati somministrati altri antipsicotici. Più recentemente l'efficacia antimaniacale di OLZ è stata dimostrata con chiarezza in osservazioni controllate. Berk e coll. (1999) hanno confrontato OLZ e sali di litio, in doppio cieco e per una durata complessiva di 4 settimane, nel trattamento di 30 pazienti che soddisfacevano i criteri del DSM-IV per la diagnosi di mania acuta. Non sono state documentate differenze significative fra i due gruppi a confronto alla BPRS ed alla Mania Scale (MS); l'OLZ è però risultata superiore rispetto al litio alla CGI-severity scale al termine della quarta settimana di sperimentazione (Litio = 2.83, OLZ = 2.29; p = 0.025). Tohen e coll. (1999) hanno riportato i dati relativi al confronto fra OLZ e placebo nel trattamento della mania acuta. A tale scopo è stato condotto uno studio in doppio cieco, randomizzato, controllato verso placebo e della durata di 3 settimane. Dall'analisi dei risultati è emerso che il gruppo trattato con OLZ presentava un miglioramento clinicamente significativo sulla base dei punteggi totalizzati alla Young Mania Rating Scale; inoltre, la percentuale di pazienti che avevano risposto, era maggiore per l'OLZ (48.6%) rispetto al placebo (24.2%). OLZ è, tra gli APA, quello che presenta minori interazioni e può essere utilizzato con minori problemi in associazione con stabilizzanti, benzodiazepine ed antidepressivi. Gonzales-Pinto e coll. (2001) hanno impiegato OLZ, in combinazione con stabilizzanti in 44 pazienti maniaci ospedalizzati che soddisfacevano i criteri di McElroy e coll. (1996) per la diagnosi di Mania Disforica. Una buona risposta clinica era presente in 40 pazienti, con un miglioramento significativo della componente depressiva, in assenza di effetti collaterali o reazioni avverse di rilievo. Al fine di valutare efficacia e sicurezza di OLZ nel trattamento della mania acuta di bambini ed adolescenti, Frazier e coll. (2001) hanno condotto uno studio in aperto della durata di 8 settimane su di un campione di 23 soggetti bipolari (maniaci, ipomaniaci o misti) di età compresa fra 5 e 14 anni; gli autori hanno somministrato OLZ in monoterapia ed a dosaggi compresi fra 2,5 e 20 mg/die. Nei 22 pazienti (96%), che avevano completato la sperimentazione, la terapia con OLZ era in grado di promuovere un miglioramento significativo della sintomatologia clinica in assenza di effetti collaterali extrapiramidali. Vieta e coll. (2001) si sono proposti di stimare l'efficacia di OLZ in pazienti con BD scarsamente responsivo all'impiego dei soli stabilizzanti il tono affettivo. A tale scopo sono stati selezionati 23 soggetti con diagnosi di BD (Tipo I e Tipo II) già in trattamento con sali di litio, valproato o carbamazepina cui veniva aggiunta, a dosaggi crescenti, OLZ. L'osservazione ha avuto una durata di 43 settimane e il dosaggio medio di OLZ utilizzato è stato di 8,1 mg/die. L'analisi dei risultati ha permesso di rilevare una sensibile riduzione dei punteggi alla CGI con miglioramento della sintomatologia, sia depressiva che maniacale. Fra le reazioni avverse riportate si è osservata sonnolenza ed incremento ponderale. Sanger e coll. (2001) hanno portato a termine un'estensione a 43 settimane, in aperto, di una precedente loro sperimentazione in doppio cieco, controllata vs placebo e della durata di 3 settimane, relativa all'impiego di OLZ in 139 pazienti con BD Tipo I in fase espansiva. Dall'analisi dei risultati effettuata al termine del periodo di follow-up, OLZ si è dimostrata efficace, sia in monoterapia che in associazione a sali di litio e/o fluoxetina, nel migliorare la sintomatologia affettiva, ciò con associato un buon profilo di sicurezza. Il problema relativo all'eventuale presenza di predittori clinici di risposta all'OLZ in pazienti con disturbi dell'umore è stato affrontato da Zarate e coll. (1998) che hanno analizzato risultati relativi all'impiego di tale antipsicotico su di un campione di 150 pazienti. Gli autori hanno concluso che una risposta da "moderata" a "marcata" si correla più spesso con variabili quali la giovane età, una diagnosi di BD, una durata di malattia più breve, un periodo di ricovero più corto prima della somministrazione di OLZ, ed una durata della sperimentazione più lunga.

RISPERIDONE

Fra i nuovi APA, il risperidone (RP) è stato il primo ad essere introdotto nella pratica clinica. Il farmaco appare dotato di tossicità inferiore a quella della CLO e, in diversi studi clinici comparativi su pazienti psicotici, è risultato parimenti efficace (Heinrich e coll. 1994). A dosi inferiori a 6 mg/die il farmaco possiede alcune delle caratteristiche di atipicità, tuttavia a dosi più elevate produce effetti extrapiramidali e fenomeni discinetici, al pari di altri APT. Anche per il RP è stata suggerita un'efficacia antimaniacale. Alcuni dati, tuttavia, indicano come il farmaco possa indurre un'esacerbazione dei sintomi maniacali, soprattutto quando somministrato in dosi elevate e senza uno stabilizzante dell'umore (Dwight e coll. 1994; Diaz, 1996). Il primo report disponibile in letteratura e relativo all'efficacia antimaniacale di RP è quello di Roose e coll. (1988). In tale esperienza, 3 pazienti psicotici in fase acuta su 4 trattati, con diagnosi di mania bipolare, mista e disturbo schizoaffettivo, avevano risposto ad una monoterapia a dosaggi medi di 4.9 mg/die. La durata media del follow up era di 8 mesi e mezzo. Successivamente sono state pubblicate altre osservazioni sull'efficacia di RP nel trattamento della mania acuta, in monoterapia o in combinazione. Singh e Catalan (1988) hanno segnalato una riduzione del punteggio alla YMRS pari al 77% nel corso di una monoterapia con RP, a dosi di 2-4 mg/die per una durata di 7-10 giorni, in 4 pazienti HIV positivi con sintomi acuti di mania psicotica. Goodnick (1995) ha riportato un miglioramento della sintomatologia maniacale in 2 pazienti bipolari trattati con RP in monoterapia o in associazione a sali di litio, a dosaggio medio di 6.5 mg/die. Infine, Thoen e coll. (1996) hanno riportato i dati relativi a 13 pazienti maniaci trattati in aperto, dei quali 10 (77%) presentavano una riduzione pari al 50% del punteggio alla YMRS e alla BPRS al termine della seconda settimana ed 8 del 75% al termine della sesta settimana. Altri studi in aperto, effettuati su pazienti ambulatoriali adulti oppure anziani con diagnosi di BD o Schizoaffettivo, hanno riportato percentuali di risposta al RP del 50% o anche superiori (Ghaemi e coll. 1997; Shaffer e Shaffer, 1996). Le osservazioni cliniche citate si riferiscono a casi clinici singoli o a piccole serie di pazienti bipolari trattati in aperto, spesso con combinazioni farmacologiche. Si comprende facilmente come i risultati ottenuti, per quanto incoraggianti, non consentono di trarre indicazioni sufficienti. Questo in considerazione del fatto che esistono anche osservazioni su casistiche simili che hanno fornito risultati in aperto contrasto con quelli sopra riportati. Sajatovic e coll. (1996) hanno, infatti, osservato che 5 (100%) pazienti in fase maniacale su 5 trattati con RP, avevano interrotto il farmaco per assenza di risposta o a causa degli effetti collaterali; in alcuni casi vi era stata una esacerbazione della sintomatologia espansiva. A tale proposito è necessario aggiungere che in letteratura sono riportati 5 "case reports" relativi a fasi maniacali indotte da RP (O'Cronin e Holt, 1995; Diaz, 1996;  Tomlison, 1996; Barkin e Pais, 1997); inoltre, è stata descritta l'esacerbazione della sintomatologia maniacale in una serie di 6 soggetti schizoaffettivi trattati con RP (Diaz, 1996). Per quanto riguarda la depressione psicotica ed il disturbo schizoaffettivo-tipo depressivo, Hillert e coll. (1992) hanno riportato percentuali di risposta al RP pari al 70%, con un dosaggio medio di 6 mg/die; risultati positivi sono stati segnalati anche da Dwight e coll. (1994), che hanno somministrato RP ad 8 pazienti depressi schizoaffettivi oppure misti. Più recentemente, Vieta e coll. (2001) hanno riportato i dati relativi ad un trial clinico della durata di 6 settimane che prevedeva la somministrazione di RP in un campione di 102 pazienti affetti da disturbo schizoaffettivo, tipo bipolare. Avevano completato le 6 settimane di osservazione 95 pazienti ed è stato possibile concludere che RP possiede buone proprietà, sia antipsicotiche che stabilizzanti dell'umore; il farmaco è risultato inoltre ben tollerato, anche in relazione all'eventuale comparsa di sintomatologia extrapiramidale. Sempre di recente, Janicak e coll. (2001) si sono proposti di mettere a confronto l'efficacia e la sicurezza di RP rispetto all' aloperidolo in una sperimentazione randomizzata, in doppio cieco condotta su 62 pazienti schizoaffettivi, 29 tipo depressivo e 33 tipo bipolare. Al termine di tale ricerca è stato possibile rilevare che: a) l'aloperidolo produce effetti extrapiramidali maggiori rispetto al RP con conseguente percentuale maggiore di drop-out; b) non sono emerse differenze statisticamente significative fra i due gruppi in relazione all' efficacia sulla sintomatologia maniacale e psicotica; c) il RP è più efficace dell'aloperidolo sulla sintomatologia depressiva associata. In buona sostanza, il complesso di dati a disposizione sarebbe indicativo di una possibile efficacia del RP nelle forme maniacali o miste, da valutare meglio in studi controllati. A differenza degli APT il farmaco potrebbe avere proprietà antidepressive significative. La maggior parte dei dati si riferisce comunque ad osservazioni a breve termine. Nei trattamenti prolungati la tollerabilità di RP non è stata adeguatamente valutata nei pazienti con disturbi dell'umore. È possibile, infatti, che nel tempo RP tenda a produrre, analogamente ad alcuni APT, una maggiore incidenza di effetti extrapiramidali e di sintomi depressivi, con appiattimento e ritiro sociale. Keck e coll. (1995), mediante una revisione delle cartelle cliniche di 144 pazienti trattati consecutivamente con RP per un periodo di almeno due settimane, hanno riscontrato un miglioramento da "moderato" a "marcato" nei soggetti più giovani, con diagnosi di BD o schizoaffettivo-tipo depressivo, con una storia di malattia mentale più breve e con un minor numero di ospedalizzazioni nell'epoca antecedente l'inizio della terapia. Risultati sostanzialmente sovrapponibili erano stati riportati precedentemente da Dwight e coll. (Diaz, 1996).

QUETIAPINA

La quetiapina (QTP) è un nuovo antipsicotico atipico da poco in commercio sul mercato italiano. La letteratura psichiatrica internazionale relativa all'uso di tale prodotto nel trattamento dei disturbi dell'umore è ancora molto scarsa. Ghaemi e coll. (1999) hanno effettuato una revisione delle cartelle cliniche di 6 pazienti con diagnosi di Disturbo Bipolare I secondo i criteri del DSM-IV, che si erano dimostrati resistenti oppure intolleranti nei confronti degli stabilizzanti tradizionali e ai quali era stata somministrata QTP. Dall'analisi dei risultati è emerso che 2 pazienti su 6 avevano risposto favorevolmente; il farmaco era ben tollerato e l'effetto collaterale riscontrato più frequentemente era la sedazione.   Zarate e coll. (2000b) si sono proposti di valutare la possibile efficacia di QTP nel trattamento dei disturbi affettivi psicotici e non, prefiggendosi anche di identificare eventuali predittori di risposta. Sono stati trattati con QTP 145 pazienti con diagnosi di BD (maniacale, misto, depressivo), DDM con sintomi psicotici, schizofrenia, disturbo schizoaffettivo (tipo bipolare o depressivo), disturbo delirante o psicosi NAS; tutte le diagnosi sono state effettuate in accordo con i criteri del DSM-IV. Dall'analisi dei risultati è emerso che i soggetti bipolari (sia maniacali che misti o depressivi) e quelli schizoaffettivi, tipo bipolare, presentavano tassi di risposta alla QTP maggiori (> 74%) rispetto alla popolazione di schizofrenici, tuttavia tali differenze non risultavano significative dal punto di vista statistico. Madhusoodanan e coll. (2000) hanno somministrato QTP a 7 pazienti anziani ospedalizzati (età compresa fra 61 e 72 anni) con sintomatologia riconducibile a schizofrenia, disturbo schizoaffettivo o BD; a tutti erano stati somministrati precedentemente antipsicotici convenzionali o altri APA. Il criterio di risposta si è basato sulla semplice osservazione clinica delle eventuali modificazioni comportamentali; 4 pazienti su 7 sono stati considerati "responders". Fra gli effetti collaterali sono stati segnalati ipotensione transitoria, irritabilità e sonnolenza; in due pazienti si è registrata un'attenuazione di sintomi extrapiramidali preesistenti. Sajatovic e coll. (2001) hanno condotto una sperimentazione in aperto di 12 settimane con lo scopo di valutare l'efficacia e la sicurezza di QTP (range: 50-400 mg/die) in 20 soggetti con diagnosi di BD (n = 10) e disturbo schizoaffettivo (n = 10), scarsamenre responsivi al trattamento con il solo stabilizzante l'umore. Dall'analisi dei risultati è emersa la sostanziale efficacia della strategia di potenziamento con QTP, come registrato dalle diverse scale di valutazione impiegate (BPRS, HAM-D, YMRS). Il farmaco è risultato, inoltre, ben tollerato. In conclusione, da questa breve rassegna emerge che la QTP possa rappresentare realmente un'utile alternativa nel trattamento dei disturbi affettivi, in monoterapia così come in associazione, qualora la sua efficacia venga confermata in osservazioni controllate su casistiche più ampie.

Tabella 3. Profilo farmacodinamico degli antipsicotici atipici.

Farmaco

Profilo farmacodinamico: blocco recettoriale

Clozapina

D1, D2, D4, 5-HT2, 1, H1, M1

Olanzapina

D1, D2, 5-HT2, 1, H1, M1

Quetiapina

D1, D2, 5-HT2, 1, H1, M1

Risperidone

D2, 5-HT2, 1, 2, H1

Tabella 4. Affinità degli Antipsicotici Atipici per i recettori. D2 e 5-HT2A.

FARMACO

D2

5-HT2A

Rapporto 5-HT2A/D2

Clozapina

Risperidone

Olanzapina

Quetiapina

Tabella 5.  Effetti collaterali principali degli antipsicotici atipici vs aloperidolo.

Aumento ponderale

Anticolinergici

PRL

Agranulocitosi



Ipotensione

Clozapina

Olanzapina

Quetiapina

Risperidone

Aloperidolo

Tabella 6. Impiego clinico degli antipsicotici atipici nelle diverse fasi dei disturbi dell' umore.

Clozapina

Olanzapina

Risperidone

Quetiapina

Ipomania/mania

Stati misti

Depressione bipolare

Rapida ciclicità

Profilassi

SCOPO DELLA TESI

Il disturbo bipolare (BD) è un disordine affettivo nel quale il paziente sperimenta non solo lo stato depressivo, caratterizzato da sintomi cognitivi, diminuzione del tono dell'umore, anedonia, anergia e perdita di motivazione, ma anche lo stato maniacale o ipomaniacale, in cui si manifesta una sintomatologia contropolare, con evidente aumento del tono dell'umore e agitazione psicomotoria. Negli individui affetti da BD gli episodi di depressione e di mania sono ricorrenti e si alternano tra loro con modalità e durata variabili. I farmaci stabilizzanti dell'umore rappresentano il trattamento di prima scelta dell'episodio maniacale acuto, nella depressione bipolare (talvolta in associazione con un antidepressivo) e nella terapia a lungo termine del disturbo bipolare per prevenire le ricadute. Attualmente i farmaci regolatori dell'umore sono il litio carbonato e farmaci anticomiziali come acido valproico, carbamazepina, lamotrigina, gabapentin e topiramato. Tuttavia, il ruolo che alcuni antipsicotici atipici come OLZ e QTP possono svolgere nel trattamento primario o aggiuntivo nelle diverse fasi del BD rappresenta un settore di ricerca emergente. Anche se nella letteratura clinica è presente una considerevole messe di dati a favore dell'impiego di questi farmaci nella mania acuta, ben poche sono le informazioni riguardanti la loro efficacia nel trattamento della depressione bipolare e nella prevenzione delle ricadute. Pertanto, un obiettivo della presente tesi è quello di confermare, se possibile, i risultati degli studi clinici che hanno segnalato l'attività antidepressiva degli antipsicotici atipici, valutando l'efficacia della QTP nel contrastare l'insorgenza dell'anedonia, un sintomo cardine della depressione umana, in un modello preclinico di depressione, lo stress cronico variato. Un altro importante obiettivo del lavoro sperimentale oggetto della tesi è quello di individuare i meccanismi molecolari responsabili di tale effetto mediante lo studio delle modificazioni della regolazione genica indotte dalla somministrazione del protocollo di stress cronico e dal trattamento con QTP nella corteccia frontale, un'area cerebrale di centrale importanza nell' eziopatogenesi dei disturbi affettivi. I risultati ottenuti potrebbero rivestire interesse in funzione del potenziale uso clinico della QTP come farmaco stabilizzante dell'umore.

MATERIALI E METODI

STRESS CRONICO VARIATO (CMS)

STABULAZIONE E MANIPOLAZIONE DEGLI ANIMALI

Per la realizzazione di questa ricerca sono stati impiegati ratti albini maschi del ceppo Wistar (Charles River, Italia). Il peso medio dei ratti all'inizio della sperimentazione era di 180 g.

Al termine del periodo di pre-stabulazione i ratti sono stati alloggiati in gabbie trasparenti di plexiglas con superficie minima del fondo di 935 cm² rivestita con una lettiera di tutolo di mais depolverato. Sono stati predisposti tre animali per gabbia e la stabulazione è stata condotta in condizioni standard con controllo costante di temperatura, umidità e illuminazione. All'interno dello stabulario la temperatura è stata mantenuta a 24 ± 2°C, umidità al 60 ± 5% e l'illuminazione ha previsto un ciclo di 12 ore di luce e 12 ore di buio.

Per tutta la durata della stabulazione i ratti hanno avuto libero accesso ad acqua e cibo e sono stati manipolati quotidianamente per addestrarli alla presa dell'operatore.

Tutte le pratiche di stabulazione, manipolazione e sperimentazione sono state condotte in conformità con la normativa CEE 86/609, OJL 358, 1 Dicembre 12, 1987; NH Guide for Care and Use of Laboratory Animals, NH Publications n° 85 - 23, 1985; D.L. 116/92.

SCELTA DEI RATTI PREFERENTI AL SACCAROSIO

In condizioni normali il ratto tende a prediligere il sapore di una soluzione zuccherina rispetto all'acqua.

La valutazione della preferenza al saccarosio ha richiesto la messa a punto di un protocollo preliminare, che consente di individuare ed eventualmente scartare gli animali che non mostrano tale preferenza.

Il protocollo prevede che gli animali vengano prelevati dal loro abituale locale di stabulazione e alloggiati singolarmente in gabbie di plexiglas nel luogo di sperimentazione. Ogni animale viene fatto ambientare alla nuova situazione per 30 minuti. Al termine vengono disposti sulla reticella di copertura di ogni gabbia due biberon della capacità di 250 ml (Tecniplast-Gazzada S.a.r.l. - Varese), dotati di un cappuccio dosatore in acciaio con un foro d'uscita del diametro di 0.8 mm (Mod. ACCP 2511 - Tecniplast-Gazzada S.a.r.l. - Varese). Un biberon deve contenere acqua potabile, l'altro una soluzione di saccarosio al 2%.

I biberon vengono posizionati sempre all'estremità sinistra della grata di copertura, avendo cura di porre più esternamente quello contenente l'acqua che, nelle normali condizioni di stabulazione, è invece posizionato all'estremità destra.

Il peso dei due biberon viene rilevato prima di iniziare il test e successivamente ogni 2 ore per tutta durata della sperimentazione (26 ore); in questo modo è possibile monitorare il consumo individuale di acqua e di soluzione zuccherina. Al termine delle prime sei ore gli animali vengono mantenuti nelle stesse condizioni, ricevono il cibo e passano la notte nel locale di sperimentazione.

Le ultime due rilevazioni sul consumo di acqua e soluzione zuccherina vengono effettuate alla 24a ora e alla 26a ora dall'inizio del test.

Effettuata l'ultima rilevazione, la sperimentazione viene considerata conclusa; gli animali vengono riposti nelle loro gabbie abituali (è importante che siano ripristinati i gruppi di partenza per evitare inutili stress) e riportati nel luogo di stabulazione.

INDUZIONE DELL'ANEDONIA

Per poter indurre l'anedonia negli animali, i ratti sono stati sottoposti ad un ciclo di stimoli di natura stressogena secondo il metodo proposto da Katz e coll. (1981) e opportunamente modificato da Ghi e coll. (1995).

Tale protocollo prevede diversi stimoli, più o meno intensi, che vengono proposti quotidianamente per un periodo di 42 giorni.

Gli stimoli che fanno parte del protocollo CMS sono:

  • Marchiatura. Viene praticato un piccolo foro nel padiglione auricolare. Questo procedimento, che si aggiunge all'abituale numerazione della coda, oltre a causare un lieve stress, permette il riconoscimento dell'animale.
  • Sottrazione del cibo. I ratti vengono privati del cibo per un periodo di 24 ore.
  • Lettiera umida. Il truciolato di mais viene bagnato e mantenuto umido per 6 ore.
  • Lieve scuotimento. La gabbia viene scossa orizzontalmente per 10 minuti.
  • Affollamento . Vengono introdotti da 5-6 ratti in una unica gabbia per la durata di 24 ore.
  • Piano inclinato. Le gabbie vengono lasciate per 5 ore su una superficie inclinata a 45°.
  • Tail pinch. La coda di ogni ratto viene lievemente pizzicata con un morsetto per non più di 2 minuti.
  • Luce continua. E' mantenuta l'illuminazione per 24 ore.
  • Luce intermittente. Vengono impostati cicli intermittenti di luce e buio (3 ore di luce/3 ore di buio) per una durata di 24 ore.

VALUTAZIONE DELLO STATO ANEDONICO

Gli animali appartenenti ai gruppi CMS (sottoposti a stress cronico, trattati con salina) e TRATT (sottoposti a stress cronico, trattati con QTP), per tutta la durata della sperimentazione sono stati sottoposti a test settimanali di preferenza al saccarosio mediante i quali è possibile valutare l'insorgenza dello stato anedonico.

I test, della durata di 2 ore, sono stati effettuati secondo la procedura descritta in precedenza.

La preferenza al saccarosio è stata valutata anche negli animali del gruppo BAS, trattati con salina ma non sottoposti a protocollo di stress cronico.

TRATTAMENTO E PRELIEVO DELLE AREE

La QTP è stata fornita dalla ditta Astrazeneca, ed è stata somministrata i.p. alla dose di 2 mg/kg/die per 6 settimane, cioè per tutta la durata del protocollo CMS (gruppo TRATT). I due gruppi di controllo (BAS e CMS) sono stati trattati con salina sempre per 6 settimane.

Al termine del trattamento gli animali appartenenti ad ogni gruppo sperimentale sono stati sacrificati per il prelievo della corteccia frontale. Per effettuare il DNA microarray, il tessuto cerebrale proveniente da tre differenti animali è stato utilizzato per comporre un singolo campione. Tutti i campioni sono stati rapidamente immagazzinati alla temperatura di -80°C in attesa di successive analisi.

ESTRAZIONE DI RNA

Per l'estrazione dell'RNA contenuto nel tessuto cerebrale dei ratti si utilizza una soluzione monobasica di guanidina tiocianato e fenolo, il TRI-REAGENT (SIGMA®), che è in grado di lisare i campioni di tessuto separando DNA, RNA e proteine. Si utilizza 1 ml di TRI-REAGENT/100 mg di tessuto.

Il tessuto viene pesato e posto all'interno di un omogenizzatore Potter, a cui si aggiunge l'esatta quantità di TRI-REAGENT; quindi si procede a omogeneizzare il tessuto, servendosi di un pestello, in modo da ottenere il lisato.

Si trasferisce l'omogenato così ottenuto in una provetta da 2 ml, si agita per alcuni secondi e il tutto viene lasciato a riposare per 5 minuti a temperatura ambiente.

Quindi si aggiunge cloroformio (0.2 ml cloroformio/ml di TRI-REAGENT usato), si agita vigorosamente in modo da ottenere una soluzione rosa pallido e si lascia a temperatura ambiente per 10-15 minuti.

La provetta contenente il tessuto lisato e i due reagenti viene poi centrifugata a 12000 rpm per 15 minuti a 4°C. Al termine della centrifugazione si possono distinguere nella provetta, contenente il tessuto lisato, tre fasi: sul fondo la fase organica, di colore rosso, che contiene le proteine; l'interfase, costituita da DNA, e il sopranatante, dove si ritrova l'RNA.

Il sopranatante viene prelevato e trasferito in una nuova provetta, dove vengono aggiunti 0.5 ml di isopropanolo/ml di TRI-REAGENT usato. La provetta, dopo agitazione manuale, viene lasciata a temperatura ambiente per 5-10 minuti.

Quindi si procede ad una seconda centrifugazione a 12000 rpm per 10 minuti a 4°C. Attraverso centrifugazione sul fondo della provetta si è deposito l'RNA formando un piccolo pellet.

Con una pipetta, ponendo attenzione a non toccare con il puntale o asportare il pellet, si preleva ed elimina il sopranatante. A questo punto si aggiunge nella provetta contenente il pellet di RNA 1 ml di etanolo al 75%/ml di TRI-REAGENT usato in precedenza. Quindi si agita vigorosamente la provetta in modo manuale.

Infine si procede ad una terza centrifugazione, questa volta a 10000 rpm per 5 minuti a 4°C, al termine della quale con una pipetta si asporta il sopranatante. Per consentire l'evaporazione dell'etanolo in eccesso, la provetta viene lasciata aperta all'aria per qualche minuto.

All'RNA così estratto si aggiungono 30 µl di acqua contenente dietilpirocarbonato (acqua DEPC), che è in grado di inibire la RNA-asi.

La soluzione di RNA è poi messa a scaldare a 55°-60° per 10-15 minuti.

Operando nel modo descritto, è stato ottenuto RNA in soluzione, che può essere conservato nel tempo a -80°C.

Al termine dell'estrazione dell'RNA è opportuno valutarne la purezza.

Vengono preparati i campioni di RNA estratto in provette da 1.5 ml, opportunamente numerate in modo da consentire l' identificazione dei campioni. In ogni provetta vengono posti 2 µl di campione e 198 µl di Acqua milliQ. E' preparata anche una provetta contenente solo 200 µl di acqua milliQ che rappresenta il bianco. Utilizzando una spettrofotometro e ponendo ad uno ad uno i campioni in una cuvetta di quarzo, si procede alla lettura dell'assorbanza dell'RNA estratto a due lunghezze d'onda, λ=260 nm e λ=280 nm.

DNA MICROARRAY

Per analizzare la variazioni della regolazione genica abbiamo utilizzato il microarray, in particolare la tecnica dell'ibridazione in situ, sviluppata da Affimetrix. Tale tecnica è il risultato dell'interazione di due tecnologie particolari, la fotolitografia e la sintesi diretta in fase solida di oligonucleotidi.

La sintesi delle sonde oligonucleotidiche avviene direttamente su una superficie di supporto solido. Il supporto, costituito da un wafer di silicio, viene funzionalizzato con piccole sequenze di oligonucleotidi (oligo-starter), che hanno la caratteristica di possedere il gruppo reattivo protetto da gruppi fotosensibili. Grazie ad una maschera fotolitografica, è possibile indirizzare la luce in specifiche posizioni dell'array e così liberare i siti necessari per la sintesi della sequenza. Una volta deprotetti selettivamente i siti reattivi, è sufficiente incubare la superficie solida con desossiribonucleotidi protetti per allungare la catena in fase di sintesi.

Ripetendo il ciclo di deprotezione, grazie all'applicazione di maschere fotolitografiche diverse, e di incubazione, è quindi possibile aggiungere nucleotidi diversi in posizioni diverse e sintetizzare tutte le sonde necessarie per l'analisi di un genoma di interesse.

I targets, ovvero gli acidi nucleici da ibridizzare alle catene di cDNA ancorate al supporto solido, sono normalmente ottenuti dalla marcatura con molecole fluorescenti del mRNA proveniente da un dato organismo. Le sonde e i targets vengono poi messi a contatto per promuovere la reazione di ibridazione in situ. Quindi l'array viene passato attraverso uno scanner per la misurazione dei segnali fluorescenti. L'intensità dei pixel di ciascuna immagine è proporzionale al numero di molecole di tracciante presenti sullo spot e, quindi, al numero di sonde che hanno ibridizzato le sonde ancorate al supporto. Di fatto, livelli diversi di fluorescenza indicano livelli diversi di ibridizzazione e quindi di espressione genica. Il segnale rilevato dallo scanner viene poi sottoposto ad algoritmi di filtrazione e di pulizia del segnale e convertito in valori numerici.

Nel complesso il microarray, in qualità di esperimento di analisi dei profili di espressione genica, fornisce come risultato una matrice di dati, in cui le righe rappresentano i geni monitorati e le colonne corrispondono alle diverse condizioni sperimentali (punti temporali, condizioni fisiologiche, tessuti). Ogni elemento della matrice rappresenta quindi il livello di espressione di un particolare gene in uno specifico stato fisiologico.

RT-PCR REAL-TIME

La PCR real-time, denominata anche PCR quantitativa o PCR quantitativa in tempo reale (rtq-PCR), è un metodo di amplificazione e quantificazione simultanee del DNA. Il DNA è amplificato da reazioni a catena della DNA-polimerasi. Dopo ogni ciclo di amplificazione, il DNA è quantificato. I metodi comuni di quantificazione includono l'uso delle colorazioni fluorescenti, che intercalano con il DNA a doppio-filamento (ds), e gli oligonucleotidi modificati del DNA (sonde), che diventano fluorescenti una volta ibridati con il DNA. Spesso la PCR real-time è combinata con la PCR Retro Trascrizionale (RT-PCR) per quantificare l'RNA. Tale tecnica spesso è denominata RT-PCR quantitativa. Come per la RT-PCR semiquantitativa, sono richiesti diversi passaggi per sviluppare un'analisi quantitativa di PCR real-time: la produzione di templati puliti, la progettazione di primers e l'ottimizzazione degli stati di reazione. In una reazione tipica, il prodotto di PCR si raddoppia ad ogni ciclo di amplificazione. Siccome sono necessari parecchi cicli affinché abbastanza prodotto sia rilevabile, il diagramma della fluorescenza sul numero dei cicli esibisce un andamento sigmoide. Nei cicli finali, i substrati di reazione iniziano a scarseggiare, i prodotti di PCR non raddoppiano e la curva comincia ad appiattirsi. Il punto sulla curva in cui la quantità di fluorescenza comincia ad aumentare velocemente, di solito alcuni scarti quadratici medi sopra la linea di base, è chiamato il ciclo della soglia (valore di Ct). Il diagramma di Ct sul DNA stampo è lineare e, così, un confronto dei valori di Ct fra reazioni multiple permette di calcolare la concentrazione dell'acido nucleico che si vuole quantificare. La pendenza di questa linea fornisce inoltre una misura dell'efficienza della PCR. Alcuni strumenti permettono ai ricercatori di generare curve di melting che seguono il completamento della PCR. Le curve di melting forniscono un'indicazione della purezza del prodotto di reazione e rivelano la presenza di dimeri dei primers. I prodotti di PCR possono essere quantificati generando una retta standard o rapportando la loro quantità rispetto a quella di un gene di controllo. La quantificazione da PCR real-time, basata su una retta standard, può utilizzare DNA la cui concentrazione assoluta in ciascuno standard è nota. Si deve essere certi, tuttavia, che l'efficienza della PCR sia la stessa per i campioni noti e per quelli incogniti. Il metodo della quantificazione relativa è più semplice, poiché richiede la quantificazione di geni di controllo o housekeeping per normalizzare l'espressione del gene studiato. Tuttavia, la selezione dei geni di controllo adatti può causare problemi, poiché possono non essere espressi ugualmente attraverso tutti i campioni incogniti. Ciò può essere risolto normalizzando le misure con un insieme di geni housekeeping per evitare il problema della variabilità.

PREPARAZIONE PRIMERS PER IL SETTAGGIO DELLA REAL-TIME

Per realizzare la tecnica Real-Time utilizziamo il Brillant SYBR Green QPCR Master MIX della Stratagene (Codice prodotto 600548).

Per ogni singola applicazione di Real-Time è necessario preventivamente settare i primers senso (SE) e antisenso (AS), sia per il gene di controllo (ACTINA o GADPH), sia per il GOI (Gene of Interest).

Al fine di evidenziare eventuali errori dipendenti dall'azione dell'operatore, è opportuno che il settaggio dei primers venga proposto in doppio.

Inoltre è indispensabile che tutte le operazioni sperimentali vengano effettuate rigorosamente in ghiaccio.

I primer vengono settati predisponendo soluzioni a concentrazioni variabili, 50 nM, 150 nM e 300 nM.

Secondo il protocollo della Stratagene il volume finale della miscela di reazione dovrà essere di 25 μl.

Le diverse soluzioni madre di primers (nelle quantità indicate nella tabella della pagina seguente) vanno aggiunti alle mix di reazione in singole provette (STARGENE 401428-tubi 401425-tappi), in modo tale da determinare tutte le combinazioni possibili di concentrazione.

CALCOLO MIX PRIMER PER REAL TIME da 3 μM

Primer SE

Primer AS

μM

μM

μM

μM

μM

μM

Acqua da aggiungere

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

(12.125-(AS+SE)-(cDNA))

All'interno di ogni tubo di reazione pongo 0.25 μl di campione.

A questo punto è possibile preparare in una provetta sterile la mix di reazione che, per ogni singolo campione, è così formata:

12.5 μl di mastermix + 0.375 μl di Rox = 12.875 μl

Quindi si aggiunge la mix di reazione al campione contenuto nel tubo.

PREPARAZIONE DELLA CURVA DI TARATURA

Per procedere nella realizzazione della Real-Time è necessario preparare una curva di taratura che consente di risalire alla concentrazione di DNA presente nel campione. Considerando di analizzare due geni, la curva va riproposta in doppio o in triplo, per tutti i geni in esame. E' importante utilizzare uno standard di riferimento come l'actina o il GADPH.

Per preparare una corretta curva di taratura devo considerare il range di diluizione in cui ricade il campione di cDNA sottoposto a real-time.

Il campione in analisi, nel protocollo di real-time utilizzato durante il nostro studio, è diluito di 50 volte. Quindi devo creare una retta di taratura che necessariamente ricada entro tale valore di diluizione.

Si preparano tre diverse strisce di tubi da RT, una per l'actina e due per i geni di interesse, come mostrato nella figura seguente.

Le strisce sono costituite da 8 tubi, due per ciascuna diluizione da effettuare.

Si preparano 4 tubi e, dopo averli numerati, si procede come di seguito indicato:

TUBO 1 = 18 μl di cDNA + 45 μl di Acqua MilliQ = 63 μl tot.

In questo modo si ottiene una diluizione di 3,5 volte.

A questo punto si prelevano 7.125 μl di campione dal tubo 1 e si distribuiscono in ognuno dei tubi di reazione (2 per actina e 2 per ogni GOI).

TUBO 2 = si prelevano 18 μl dal tubo 1 e si diluiscono ancora di 3.5 volte, aggiungendo sempre 45 μl di acqua (diluizione finale: 3.5

A questo punto si prelevano 7.125 μl di campione dal tubo 2 e si distribuiscono in ognuno dei tubi di reazione (2 per actina e 2 per ogni GOI).

TUBO 3 = si prelevano 18 μl dal tubo 2 e si diluiscono ancora di 3.5 volte (diluizione finale: 12.25

A questo punto si prelevano 7.125 μl di campione dal tubo 3 e si distribuiscono in ognuno dei tubi di reazione (2 per actina e 2 per ogni GOI).

TUBO 4 = si prelevano 18 μl dal tubo 3 e si diluiscono ancora di 3.5 volte (diluizione finale: 42.875

A questo punto prelevo 7.125 μl del campione del tubo 3 e si distribuisco in ognuno dei tubi di reazione (2 per actina e 2 per GOI).

Una volta conclusa l'operazione di distribuzione si prepara la mix di reazione, tenendo presente che la quantità di cDNA aggiunto è stata di 7.125 μl e che il volume finale in ogni tubo deve essere di 25 μl.

PREPARAZIONE DELLA MIX DI REAZIONE PER L'ACTINA:

MIX 2X = 12.5 (n° campioni + 1)

ROX = 0.375 (n° campioni + 1)

PRIMER SE = 2.5 (n° campioni + 1)

PRIMER AS = 2.5 (n° campioni + 1)

In ogni singolo tubo devono essere aggiunti 17.825 μl di mix di reazione per actina.

PREPARAZIONE DELLA MIX DI REAZIONE PER GOI:

MIX 2X = 12.5 (n° campioni + 1)

ROX = 0.375 (n° campioni + 1)

PRIMER SE = 2.5 (n° campioni + 1)

PRIMER AS = 2.5 (n° campioni + 1)

In ogni singolo tubo devono essere aggiunti 17.825 μl di mix di reazione per GOI.

PREPARAZIONE DEI CAMPIONI

Si preparano tre strisce di tubi, una per l'actina e una per ognuno dei due GOI.

In ogni singolo tubo vengono posti 0.25 μl di campione.

Nel tubo 7 (bianco) non va aggiunto il campione, ma solo l'acqua in quantità finale di 7.125 μl. Quest'ultimo tubo rappresenta il controllo, per verificare che i campioni non siano contaminati o che non si siano verificati errori nella preparazione.

A questo punto è possibile preparare la mix di reazione per l'actina e per GOI, che, per ogni campione, sarà composta come qui di seguito indicato.

ACTINA:

MIX 2X = 12.5 μl

ROX = 0.375 μl

PRIMER SE = 2.5 μl

PRIMER AS = 2.5 μl

ACQUA = 6.875 μl

GOI:

MIX 2X = 12.5 μl

ROX = 0.375 μl

PRIMER SE = 2.5 μl

PRIMER AS = 2.5 μl

ACQUA = 6.125 μl

A questo punto, dopo aver alloggiato i tubi di reazione nel termociclatore per Real-Time, parte il programma di amplificazione, al termine del quale è possibile verificare la quantità di cDNA presente in ogni tubo.

RT-PCR SEMIQUANTITATIVA

Kary Mullis nel 1993 ricevette il premio Nobel per aver messo a punto la tecnica della Reazione a Catena della Polimerasi (PCR).

La RT-PCR semiquantitativa è un metodo che consente di produrre un numero estremamente grande di copie di una specifica sequenza di DNA a partire dal genoma cellulare, mediante un processo di amplificazione.

Grazie all'azione dell'enzima retrotrascrittasi inversa, è possibile retrotrascrivere l'RNA a singolo filamento ed ottenere i corrispondenti cDNA a doppia elica. I cDNA sono poi utilizzati come stampo per l'amplificazione della sequenza di DNA e per la valutazione dell'espressione genica.

Utilizzando una soluzione contenente i cDNA, gli oligonucleotidi, i primers (in grado di legare in modo specifico la sequenza di DNA), i desossiribonucleotidi trifosfati, gli ioni magnesio e la DNA Polimerasi, attraverso un termociclatore, è possibile promuovere l'estensione dei primers con la DNA Polimerasi e riprodurre una nuova copia della sequenza genica in esame attraverso un primo ciclo di PCR. In modo estremamente rapido, cicli successivi e ripetuti di PCR produrranno un numero esponenziale di sequenze specifiche del DNA in analisi.

I primers vengono creati sinteticamente sulla base della sequenza di DNA oggetto di studio al fine di permettere l'appaiamento e il legame dei primers stessi alle regioni complementari di cDNA.

RETROTRASCRIZIONE

L'RNA a singolo filamento, estratto dal tessuto cerebrale di ratto, deve essere retrotrascritto in modo da ottenere il doppio filamento di cDNA, che sarà poi utilizzato per la successiva reazione di amplificazione tramite PCR.

Durante lo studio ci siamo avvalsi dell'uso del KIT PROOMEGA® (ImProm-II Reverse Trascription System).

In tubi sterili e immersi nel ghiaccio si preparano i campioni di RNA e, per ogni campione, si aggiungono nel seguente ordine:

1) RNA totale 0.1-5 ng = 2 µl. E' necessario che l'RNA totale sia comunque superiore a 1 mg/reazione.

2) Oligo(dT)15 primer = 1 µl. Sono necessari 0.5 mg Oligo(dT)15 primer/r azione.

3) Nuclease Free Water = 2 µl. Il protocollo consente l'aggiunta di Nucleare Free Water fino ad un volume massimo di 5 ml, in funzione della quantità di RNA totale utilizzato.

Il volume finale di ogni campione di RNA da retrotrascrivere è di 5 ml.

I tubi di reazione vengono poi riscaldati a 70°C per 5 minuti al termine dei quali le provette devono essere prontamente riposte in ghiaccio per 5 minuti.

Nel frattempo si prepara la miscela di reazione, avendo cura di aggiungere solo in ultimo gli enzimi necessari per la retrotrascrizione, in quanto soggetti a facile degradazione. Per ogni campione si preparano 15 µl di miscela di reazione aggiungendo nell'ordine:

1) Nuclease Free Water = 7.3 µl. Il protocollo consente l'aggiunta di Nucleare Free Water fino ad un volume massimo di 15 ml.

2) Improm-II 5X Reaction Buffer = 4 µl

3) MgCl2, 25 mM = 1.2 µl. La concentrazione finale di MgCl2 deve essere compresa tra 1.5-8 mM.

4) dNTPs Mix 10mM = 1 µl. La concentrazione finale di dNTPs deve essere di 0.5 mM.

5) l'enzima Recombinant RNasi Ribonuclease Inhibitor = 0.5 µl

6) l'enzima Improm-II Riverse Transcriptase = 1 µl

A questo punto, in ogni singola provetta contenente il campione di RNA precedentemente preparato (5 µl), si aggiungono 15 µl di miscela di reazione per ottenere un volume finale di 20 µl.

Le provette vengono poste nel termociclatore dove vengono sottoposte ai 3 seguenti passaggi:

1°: 25°C per 5 minuti

2°: 42°C per 60 minuti

3°: 70°C per 15 minuti

Il passaggio finale ha lo scopo di inattivare gli enzimi.

Procedendo in questo modo, abbiamo trasformato il filamento singolo di RNA estratto in un doppio filamento di cDNA, pronto per essere amplificato tramite PCR.

Dopo retrotrascrizione dell'RNA, i campioni di cDNA possono essere conservati nel tempo a -80°C.

AMPLIFICAZIONE

Per l'amplificazione del cDNA retrotrascritto abbiamo utilizzato la tecnica PCR (Reazione a Catena della Polimerasi).

E' necessario che tutte le operazioni di preparazione previste dal protocollo di amplificazione vengano eseguite rigorosamente in ghiaccio.

In una provetta da 1.5 ml si prepara la miscela di reazione, avendo cura di aggiungere solo in ultimo la Taq Polimerasi, una DNA Polimerasi resistente al calore. La miscela di reazione, 20 µl per ogni campione di cDNA (5 µl), deve contenere:

Buffer 10X (EPPENDORF®) = 2.5 µl

Mix Primer AS+SE 5 μM = 2.5 µl. La concentrazione finale di Mix Primer AS+SE deve essere di 0.5 µM.

MgCl2 25 mM (EPPENDORF®) = 1 µl. La concentrazione finale di MgCl2 deve essere di 1 mM, ma il protocollo consente piccole variazioni di molarità.

dNTPs 10 mM (PROOMEGA®) = 0,5 µl. La concentrazione finale di dNTPs deve essere di 0.2 mM, ma il protocollo consente piccole variazioni di molarità.

Taq Polimerasi (EPPENDORF®) = 0.1 µl

Quindi si aggiunge alla miscela di reazione acqua milliQ in quantità tale da ottenere un volume finale di miscela di 20 µl per ogni campione (20-6.6 = 13.4 µl acqua milliQ).

A questo punto, in ogni singola provetta, contenente 5 µl di campione di cDNA precedentemente preparato, vengono aggiunti 20 µl di miscela di reazione per ottenere un volume finale di 25 µl.

Le provette contenenti cDNA e miscela di reazione vengono poste nel termociclatore dove saranno sottoposte a cicli termici.

CARATTERISTICHE PRIMERS

Bax SENSO - GAGACACCTGAGCTGACCTT -

Len

MW

Tm: 61.05° C

GC

Sec. Str.: None

Primer Dimer: No

Bax ANTISENSO - ATCTTTGTGGCTGGAGTCCT

Len

MW

Tm: 62.62° C

GC

Sec. Str.: None

Primer Dimer: No

Bad SENSO - TTGAGCCGAGTGAGCAGGAA -

Len

MW

Tm: 68.43° C

GC

Sec. Str.: None

Primer Dimer: No

Bad ANTISENSO - CTATGGCCGTGAGCTCCGAA - VEDERE

Len

MW

Tm: 69.52° C

GC

Sec. Str.: None

Primer Dimer: No

Bcl2 SENSO - CCGGGAGATCGTGATGAAGT

Len

MW

Tm: 66.28° C

GC

Sec. Str.: None

Primer Dimer: No

Bcl2 ANTISENSO -TGGTGGACAACATCGCTCTG

Len

MW

Tm: 67.44° C

GC

Sec. Str.: None

Primer Dimer: No

Bcl2l1 SENSO - CTGTGGAGATCCCTAACTGC -

Len

MW

Tm: 61.25° C

GC

Sec. Str.: None

Primer Dimer: No

Bcl2l1 ANTISENSO - CAGCCTGTGTGTTTACT -

Len

MW

Tm: 60.78° C

GC

Sec. Str.: None

Primer Dimer: No

Tieg SENSO - ACAGTTTGCT TCCAGGGACG -

Len

MW

Tm: 66.36° C

GC

Sec. Str.: None

Primer Dimer: No

Tieg ANTISENSO AGGTCTTCTCAGCCAGCTCC -

Len

MW

Tm: 64.94° C

GC

Sec. Str.: None

Primer Dimer: No

Ebag9 SENSO - AGCAGACAGACGTGGAGGA -

Len

MW

Tm

63.83° C

GC

Sec. Str.: None

Primer Dimer: No

Ebag9 ANTISENSO - CCCAGATGGTAGCACAGGT - VEDERE

Len

MW

Tm

62.61° C

GC

Sec. tr.: None

Primer Dimer: No

Sgk SENSO - TGCTCGAAGTACCCTCACCT -

Len

MW

Tm: 63.74° C

GC

Sec. Str.: None

Primer Dimer: No

Sgk ANTISENSO - TTAATGGCGGAGAGCTGTTC -

Len

MW

Tm: 64.08° C

GC

Sec. Str.: None

Primer Dimer: No

Stk17b SENSO - GGCCACAGACTTCATCCAGA - VEDERE

Len

MW

Tm: 65.31° C

GC

Sec. Str.: None

Primer Dimer: No

Stk17b ANTISENSO - CGATTCGATGACTCCTTGCC -

Len

MW

Tm: 66.85° C

GC

Sec. Str.: None

Primer Dimer: No

Nlgn3 SENSO - TCATGCTAGGCGTCAACCAG -

Len

MW

Tm: 66.25° C

GC

Sec. Str.: None

Primer Dimer: No

Nglgn3 ANTISENSO - ACCATCACTGCCAGAGCCTC -

Len

MW

Tm: 66.77° C

GC

Sec. Str.: None

Primer Dimer: No

Itgam SENSO - AGCTGGTGATCACGTGTTCC - VEDERE

Len

MW

Tm: 65.21° C

GC

Sec. Str.: None

Primer Dimer: No

Itgam ANTISENSO - TGCAGTCATCTCGAGGAACC - VEDERE

Len

MW

Tm: 65.44° C

GC

Sec. Str.: None

Primer Dimer: No

Itga6 SENSO - GGCCAGTTGTGCTTGCTCTA -

Len

MW

Tm: 65.36° C

GC

Sec. Str.: None

Primer Dimer: No

Itga6 ANTISENSO - TTCTGTGATGGCCGATTGAG -

Len

MW

Tm: 66.14° C

GC

Sec. Str.: None

Primer Dimer: No

Hes5 SENSO - ACCGCATCAACAGCAGCATT - VEDERE

Len



MW

Tm: 67.88° C

GC

Sec. Str.: None

Primer Dimer: No

Hes5 ANYISENSO - GCACCAGGACTACAGCGAGG - VEDER

Len

MW

Tm: 66.58° C

GC

Sec. Str.: None

Primer Dimer: No

Cldn10 SENSO - ATCATCGCCTTCGTCGTCTC -

Len

MW

Tm: 66.55° C

GC

Sec. Str.: None

Primer Dimer: No

Cldn10 ANTISENSO - GCATCATTGGCGGTGTCATA -

Len

MW

Tm: 66.76° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh1 SENSO - TCGCCTACACCATCCTCAGC -

Len

MW

Tm: 67.54° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh1 ANTISENSO - TTGAGAATGAGGTCGGTGCC -

Len

MW

Tm: 67.42° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh7 SENSO - TTGTGGAAGACGTGGATGAG -

Len

MW

Tm: 63.79° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh7 ANTISENSO - GCTCAGCCAGGACAGGTTAT -

Len

MW

Tm: 63.13° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh22 SENSO - GAGTACACGGGGACAGAACC -

Len

MW

Tm: 63.36° C

GC

Sec. Str.: None

Primer Dimer: No

Cdh ANTISENSO - AAGAAAGTGGCAGTGGAGGA -

Len

MW

Tm: 63.73° C

GC

Sec. Str.: None

Primer Dimer: No

ACTINA SENSO - ACATCGGCAAAGACTTGTACG

Len

MW

Tm: 61.10° C

GC

Sec. Str.: None

Primer Dimer: No

ACTINA ANTISENSO - AGCATTTGCGGTGGACGATGG

Len

MW

Tm: 73.2° C

GC

Sec. Str.: None

Primer Dimer: No

FASI DEL CICLO PCR

Fase di Denaturazione: la soluzione contenente i cDNA da replicare, i desossiribonucleotidi trifosfati, gli ioni magnesio, il primer e la DNA polimerasi (Taq Polimerasi) viene portata a una temperatura compresa tra 94-99°C. In queste condizioni avviene la denaturazione del DNA a doppio filamento, la doppia elica del cDNA si apre e vengono liberati i due filamenti singoli.

Fase di Annealing: la temperatura viene abbassata fino alla temperatura di annealing al fine di permettere il legame dei primer alle regioni complementari dei filamenti di cDNA denaturati.

Fase di Estensione: la temperatura viene aumentata fino a 65-72°C al fine di massimizzare l'azione della DNA polimerasi. Tale enzima determina l' allungamento dei primer legati, utilizzando come stampo il filamento singolo dei cDNA.

Il singolo ciclo appena descritto viene ripetuto generalmente per circa 20-30 volte.

I cicli di lavoro per i geni in esame sono i seguenti:

Al termine dei cicli di amplificazione previsti per i geni in esame, i campioni di DNA possono essere conservati nel tempo a -20°C.

CORSA ELETTROFORETICA

Attraverso la corsa elettroforetica è possibile valutare le differenze quantitative dell'espressione dei geni di interesse a partire dal DNA amplificato proveniente dai diversi campioni di ratto (basale, stressato o CMS e trattato con quetiapina).

Per la corsa elettroforetica dei campioni è stato utilizzato un gel di agarosio al 2% disciolto in una soluzione di TBE.

PREPARAZIONE TBE 100 ML 10X

In un becker contenente un'ancoretta sono stati aggiunti:

  • Tris Base = 10.8 g
  • Acido Borico = 5.5 g
  • EDTA 0,25 M = 4 ml

Si è portato a volume con 100 ml di acqua milliQ e si è sciolto il tutto utilizzando un agitatore.

La concentrazione di utilizzo del TBE è 0.5X.

PREPARAZIONE DEL GEL DI AGAROSIO 2%

In un becker sono stati aggiunti:

  • TBE (SIGMA®) = 70 ml
  • AGAR (SIGMA®) = 1.4 g

Il becker contenente il TBE e l'agarosio è portato a ebollizione in forno a microonde, in modo da sciogliere l'agarosio.

Infine si aggiungono 2 µl di etidio bromuro (SIGMA®) e si cola la miscela nell'apposito apparecchio per la corsa elettroforetica, dopo aver inserito opportunamente i pettini.

Una volta avvenuta la solidificazione del gel, si aggiunge il tampone di corsa nell'apparecchio elettroforetico e si tolgono i pettini che, intrappolati nel gel, hanno creato i pozzetti necessari per il caricamento dei campioni.

Per poter procedere al caricamento negli appositi pozzetti, i campioni e il marker devono essere preparati.

Il marker (θ174) consente di identificare i campioni di DNA aventi dimensioni che vanno da 72 a 1353 basi e deve essere preparato nel seguente modo:

  • Acqua milliQ autoclavata =  4 μl
  • Loading Day (PROOMEGA®) = 1 μl
  • Marker θ174 (PROOMEGA®)  = 1 μl

Invece ai campioni (ogni campione = 5 μl) deve essere aggiunto 1 μl di Loading Day.

Una volta che i campioni e il marker sono stati opportunamente caricati, si può dare inizio alla corsa elettroforetica a 90-100 V.

RISULTATI

STRESS CRONICO VARIATO

Gli effetti provocati dalla somministrazione cronica di salina, QTP o AMI sul consumo di saccarosio di ratti naive o sottoposti al protocollo di stress cronico sono illustrati nella figura 2.

L'analisi della varianza (ANOVA) a disegno misto, applicata ai dati sperimentali ottenuti, indica un effetto significativo della variabile indipendente "trattamento" (F 3/44 = 96.4; p < 0.001) e della variabile dipendente "data del test di preferenza al saccarosio" (F 5/220 = 11.1; p < 0.001). Anche l'interazione tra le due variabili è statisticamente significativa (F 15/220 = 8.2;

p < 0.001). La successiva analisi indica che il gruppo trattato con salina e sottoposto al protocollo CMS riduce progressivamente il consumo di saccarosio rispetto al basale, stabilizzandosi su valori pari a circa il 50%, intorno alla terza settimana dall'inizio della sperimentazione (F 1/44 = 281; p < 0,001). Sia il trattamento con QTP 2 mg/kg/die (F 1/44 = 65; p < 0.001) che quello con AMI 2 mg/kg/die (F 1/44 = 112; p < 0.001) sono in grado di contrastare la progressiva riduzione del consumo di saccarosio indotta dallo stress cronico. L'effetto della AMI compare intorno alla quarta settimana, mentre quello della QTP compare circa una settimana dopo. Pertanto, la differenza statisticamente significativa tra il gruppo trattato con QTP e quello trattato con la AMI, antidepressivo triciclico utilizzato come standard di riferimento (F 1/44 = 6,4; p = 0.015), deriverebbe dalla diversa latenza dei due composti nella comparsa dell'effetto.

Figura 2. Effetto del trattamento cronico con QTP e AMI sull'anedonia indotta dal protocollo di stress cronico variato

DNA MICROARRAY

Il numero totale di geni presi in considerazione è 31099.

Le modificazioni nella trascrizione dei singoli geni nella corteccia frontale, provocate dallo stress cronico e dal trattamento con QTP e calcolate mediante algoritmo GCRMA, sono riportate in figura 3.

Figura 3.

In seguito a somministrazione del protocollo CMS, il numero di geni che mostra una variazione di ± 1.5 volte rispetto alle condizioni basali (confronto gruppo BAS Vs gruppo CMS) è 325 (figura 4.)

Figura 4.

Tra questi, 126 sono up-regolati (fold change da +1.5 a +3.48) e 199 down-regolati (fold change da -1.5 a -2.89).

La successiva analisi statistica, effettuata su questi geni mediante il T-Test di Welch (livello di significatività statistica p=0.01) ha indicato una differenza significativa in 63 geni, le cui caratteristiche sono riportate nelle tabelle 7. e 8. e nella figura 5.

Tabella 7. Geni up-regolati dallo stress cronico nella corteccia frontale del ratto

Genbank

QTP

Gene Symbol

Gene title

NM_138838

Pou3f1

POU domain, class 3, transcription factor 1

NM_012551

Egr1

early growth response 1

NM_053633

Egr2

early growth response 2

NM_024388

Nr4a1

nuclear receptor subfamily 4, group A, member 1

NM_017352/// NM_031628

Nr4a3

nuclear receptor subfamily 4, group A, member 3

NM_017232

Ptgs2

prostaglandin-endoperoxide synthase 2

NM_017313

RABIN3

RAB3A interacting protein

NM_024125

Cebpb

CCAAT/enhancer binding protein (C/EBP), beta

XM_221496

Esrrbl1_predicted

estrogen-related receptor beta like 1 (predicted)

NM_001024784

Nfx1_predicted

nuclear transcription factor, X-box binding 1 (predicted)

NM_080887

Txnl1

thioredoxin-like (32kD)

NM_019242

Ifrd1

interferon-related developmental regulator 1

NM_139216/// NM_139217

Kcnc2

potassium voltage gated channel, Shaw-related subfamily, member 2

NM_133317

Tob1

transducer of ERBB2, 1

NM_031135

Tieg

TGFB inducible early growth response

XM_214331

Klhl2_predicted

kelch-like 2, Mayven (Drosophila) (predicted)

XM_224894

Cnot7_predicted

CCR4-NOT transcription complex, subunit 7 (predicted)

XM_345674

Cfl2_predicted

cofilin 2, muscle (predicted)

XM_342731

Sumf1_predicted

sulfatase modifying factor 1 (predicted)

NM_001009665

Ebag9_predicted

estrogen receptor-binding fragment-associated gene 9 (predicted)

XM_232640

Sox17_predicted

SRY-box containing gene 17 (predicted)

NM_153821

Prrx1

paired related homeobox 1

NM_145085

Pcyox1

chloride ion pump-associated 55 kDa protein

NM_001009661

Wbp11_predicted

WW domain binding protein 11 (predicted)

XM_342300

Zfp364_predicted

zinc finger protein 364 (predicted)

NM_133402

Nap1l3

nucleosome assembly protein 1-like 3

XM_219292

sp31_predicted

ubiquitin specific protease 31 (predicted)

NM_001013250

Ddx21a_predicted

DEAD (Asp-Glu-Ala-Asp) box polypeptide 21a (predicted)

NM_012957

Gabrb2

gamma-aminobutyric acid receptor, subunit beta 2

NM_145678

Vps4a

vacuolar protein sorting 4a (yeast)

NM_022197

Fos

murine osteosarcoma viral oncogene homolog

NM_021836

Junb

Jun-B oncogene

NM_138921

Eml2

echinoderm microtubule associated protein like 2

NM_013150

Nrcam

neuron-glia-CAM-related cell adhesion molecole

NM_031334

Cdh1

Cadherin 1

NM_017171

Prkce

Protein Kinase c, epsilon

Figura 5.

Tra questi, 244 sono up-regolati (fold change da +1,5 a +4,25) e 70 down-regolati (fold change da -1,5 a -2,96).

La successiva analisi statistica, effettuata su questi geni mediante il T-Test di Welch (livello di significatività statistica p=0,01) ha indicato una differenza significativa in 98 geni (figura 6.)

Figura 6.

Fra i geni up-regolati dallo stress cronico, 28 (Pou3f1, Egr1, Nr4a1, Nr4a3, Ptgs2, Esrrbl1_predicted, Nfx1_predicted, Txnl1, Ifrd1, Tob1, Tieg, Klhl2_predicted, Cnot7_predicted, Cfl2_predicted, Sumf1_predicted, Ebag9_predicted, Pcyox1, Wbp11_predicted, Zfp364_predicted, Nap1l3, sp31_predicted, Gabrb2, Vps4a, Fos, Junb, Nrcam, Cdh1, Prkce) subiscono una regolazione opposta e ritornano presumibilmente alle condizioni rilevate negli animali non anedonici, 2 geni (Egr2 e Prrx1) subiscono una regolazione nello stesso verso e i rimanenti 6 non vengono modificati (RABIN3, Cebpb, Kcnc2, Sox17_predicted, Ddx21a_predicted, Eml2) dal trattamento con QTP.

Al contrario, tra i geni down-regolati dallo stress cronico, 21 (LOC306340, Dlc1, Eif2b5, Dcc, Clic1, Gna12, Snrp70_predicted, Itga6, Cdh22, Fgfr1, U2af2_predicted, Nr2f6, Camk2a, Phactr1, Homer1, Grik5, Vegf, Atp2a2, Prkcb1, Ppp3ca, Bcl2l1) subiscono una regolazione opposta, 3 geni (Mbp, Csf1 e Grid1) subiscono una regolazione nello stesso verso e i rimanenti 3 non vengono modificati (Gpr135, Mpk10, Rab21) dal trattamento con QTP.

Tabella 8. Geni down-regolati dallo stress cronico nella corteccia frontale del ratto

Genbank

QTP

Gene Symbol

Gene title

XM_224715

LOC306340

similar to mKIAA1623 protein

XM_341444

Dlc1

deleted in liver cancer 1

NM_138866

Eif2b5

eukaryotic translation initiation factor 2B, subunit 5 epsilon

NM_012841

Dcc

deleted in colorectal carcinoma

NM_001033968/// NM_053609

Clic1

Chloride intracellular channel 1

NM_031034

Gna12

guanine nucleotide binding protein, alpha 12

XM_341857

Snrp70_predicted

U1 small nuclear ribonucleoprotein polypeptide A (predicted)

NM_001025289

/// NM_001025291

/// NM_001025292

/// NM_001025293

/// NM_001025294

/// NM_017026

Mbp

myelin basic protein

XM_215984

Itga6

integrin, alpha 6

NM_019161

Cdh22

cadherin 22

NM_181771

Gpr135

G protein-coupled receptor 135

NM_024146

Fgfr1

Fibroblast growth factor receptor 1

NM_023981

Csf1

Colony stimulating factor 1

XM_218195

U2af2_predicted

U2 small nuclear ibonucleoprotein auxiliary factor (U2AF) 2 (predicted)

NM_139113

Nr2f6

nuclear receptor subfamily 2, group F, member 6

NM_012920

Camk2a

Calcium/calmodulin-dependent protein kinase II alpha subunit

NM_012806

Mapk10

Mitogen activated protein kinase 10

NM_214457

Phactr1

Phosphatase and actin regulator 1

NM_031707

Homer1

homer homolog 1 (Drosophila)

NM_024378

Grid1

Glutamate receptor, ionotropic, delta 1

NM_017262/// NM_031508

Grik5

Glutamate receptor, ionotropic, kainate 5

NM_001004238

Rab21

RAB21, member RAS oncogene family

NM_031836

Vegf

Vascular endothelial growth factor A

NM_017290

Atp2a2

ATPase, Ca++ transporting, cardiac muscle, slow twitch 2

NM_012713

Prkcb1

Protein Kinase C, beta 1

NM_017041

Ppp3ca

Protein phosphatase 3, catalytic subunit, alpha isoform

NM_001033670

///NM_00103361

///NM_001033672

///NM_031535

Bcl2l1

Bcl2-like 1

Tutti i geni regolati sono stati classificati in base al processo biologico nel quale sono coinvolti, secondo le modalità indicate dal Gene Ontology Consortium. Dall'analisi è emerso che la maggior parte di essi partecipa alla regolazione del metabolismo e della fisiologia cellulare (Tabella 9.)

TABELLA 9.

Gene Ontology:

biological process

Genes

Nº genes

Percentage

cellular physiological process

1398822_at 1389195_at 1392180_at 1384594_at 1395102_at 1385592_at 1383554_at 1368924_at 1368146_at 1380548_at 1384061_at 1383672_at 1393378_at 1376247_at 1386995_at 1375043_at 1389686_at 1398862_at

metabolism

1389195_at 1392180_at 1384594_at 1385592_at 1383554_at 1368146_at 1384061_at 1383672_at 1393378_at 1376247_at 1386995_at 1375043_at 1389686_at 1398862_at

regulation of physiological process

1389195_at 1392180_at 1385592_at 1380548_at 1384061_at 1393378_at 1386995_at 1375043_at 1398862_at

regulation of cellular process

1389195_at 1392180_at 1385592_at 1368924_at 1380548_at 1384061_at 1393378_at 1386995_at 1375043_at



positive regulation of biological process

1389195_at 1392180_at 1368924_at 1380548_at 1384061_at

cell communication

1398822_at 1384594_at 1368146_at 1398862_at 1382489_at

localization

1398822_at 1395102_at 1368924_at 1398862_at

anatomical structure development

1384061_at 1386995_at 1375043_at

negative regulation of biological process

1385592_at 1386995_at 1398862_at

death

1389195_at 1380548_at 1386995_at

cell differentiation

1368924_at 1386995_at

regulation of catalytic activity

1398822_at 1380548_at

pattern specification

1384061_at 1386995_at

regulation of development

1368924_at

organismal physiological process

1398862_at

homeostasis

1398862_at

In particolare, 9 geni codificano proteine recettoriali o proteine implicate nei meccanismi di trasduzione del segnale (Grid1, Grik5, Gabrb2, Gna12, Gpr135, Mapk10, Homer1, Rab21, RABIN3), 6 geni codificano proteine coinvolte nell'omeostasi intracellulare del calcio (Atp2a2, Prkcb1, Camk2a, Ppp3ca, Plcb1, Prkce), 6 geni codificano proteine implicate nei processi di adesione cellulare (Nrcam, Eml2, Itga6, Cdh22, Cdh1, Phactr1), 5 nell'apoptosi (Dcc, Esrrbl1, Tieg, Ebag9, Bcl2l1), 1 nella risposta infiammatoria (Ptgs2) e 12 nella regolazione della trascrizione (Eif2b5, Nr4a1, Nr4a3, Nr2f6, Pou3f1, Egr1, Egr2, Cebpb, Nfx1, Cnot7, Fos, Junb).

Sulla base di tali risultati è stata avviata l'ultima fase del lavoro, mirata a confermare, mediante RT-PCR semiquantitativa e real-time PCR, i dati sperimentali ottenuti con la tecnica del DNA array. Sono stati scelti in via preliminare due gruppi di geni coinvolti nell'apoptosi e nei processi di adesione cellulare. I geni oggetto di studio coinvolti nell'apoptosi sono Bax, Bad, Bcl2, Bcl2l1, Tieg, Ebag9, Sgk e Stk17b, mentre quelli implicati nell'adesione cellulare sono Nlgn3, Itgam, Itga6, Hes5, Cldn10, Cdh1, Cdh7 e Cdh22.

Figura 7. Regolazione genica nella corteccia frontale del cervello di ratto in 3 condizioni sperimentali differenti. BAS=ratti naive trattati con salina CMS= ratti sottoposti a protocollo di stress cronico e trattati con salina TRATT= ratti sottoposti a protocollo di stress cronico e trattati con QTP 2 mg/kg/die  A) Risultati Real time RT-PCR B) Risultati RT-PCR semiquantitativa C) Risultati DNA array. E' indicato il confronto tra i gruppi CMS/BAS e TRATT/CMS relativamente alla regolazione del gene in esame

A)

B) ù

BAS CMS TRATT

394 bp -

 

BAS CMS TRATT

422 bp -

 

BAS CMS TRATT

484 bp -

 

BAS CMS TRATT

233 bp -

 

BAS CMS TRATT

280 bp -

 
Actina

C)

DNA array  - ( -( - (

Figura 8. Regolazione genica nella corteccia frontale del cervello di ratto in 3 condizioni sperimentali differenti. BAS=ratti naive trattati con salina CMS= ratti sottoposti a protocollo di stress cronico e trattati con salina TRATT= ratti sottoposti a protocollo di stress cronico e trattati con QTP 2 mg/kg/die  A) Risultati Real time RT-PCR B) Risultati RT-PCR semiquantitativa C) Risultati DNA array. E' indicato il confronto tra i gruppi CMS/BAS e TRATT/CMS relativamente alla regolazione del gene in esame

A)

B)

BAS CMS TRATT

284 bp -

 

BAS CMS TRATT

534 bp -

 

BAS CMS TRATT

519 bp -

 

BAS CMS TRATT

220 bp -

 

BAS CMS TRATT

280 bp -

 
Actina

C)

DNA array - ( - ( ↑ (↓)

Figura 9. Regolazione genica nella corteccia frontale del cervello di ratto in 3 condizioni sperimentali differenti. BAS=ratti naive trattati con salina CMS= ratti sottoposti a protocollo di stress cronico e trattati con salina TRATT= ratti sottoposti a protocollo di stress cronico e trattati con QTP 2 mg/kg/die  A) Risultati Real time RT-PCR B) Risultati RT-PCR semiquantitativa C) Risultati DNA array. E' indicato il confronto tra i gruppi CMS/BAS e TRATT/CMS relativamente alla regolazione del gene in esame

A)

B)

BAS CMS TRATT

337 bp -

 

BAS CMS TRATT

324 bp -

 

BAS CMS TRATT

526 bp -

 

BAS CMS TRATT

174 bp -

 

BAS CMS TRATT

280 bp  -

 
Actina

C)

DNA array - ( - ( ( -

Figura 10. Regolazione genica nella corteccia frontale del cervello di ratto in 3 condizioni sperimentali differenti. BAS=ratti naive trattati con salina CMS= ratti sottoposti a protocollo di stress cronico e trattati con salina TRATT= ratti sottoposti a protocollo di stress cronico e trattati con QTP 2 mg/kg/die  A) Risultati Real time RT-PCR B) Risultati RT-PCR semiquantitativa C) Risultati DNA array. E' indicato il confronto tra i gruppi CMS/BAS e TRATT/CMS relativamente alla regolazione del gene in esame

A)


B)

BAS CMS TRATT

512 bp -

 

BAS CMS TRATT

274 bp -

 

BAS CMS TRATT

389 bp -

 

BAS CMS TRATT

753 bp -

 

BAS CMS TRATT

280 bp -

 
Actina

C)

DNA array - ( - (

DISCUSSIONE

Alcuni recenti studi clinici hanno dimostrato che la QTP può essere efficace del contrastare i sintomi depressivi associati ai disturbi psicotici e ai disturbi dell'umore. Per quanto concerne i disturbi dell'umore, Altamura e coll. (2003), Ertugrul e Meltzer (2003) e Calabrese e coll (2005) hanno studiato l'efficacia di questo derivato dibenzotiazepinico nel BD tipo I e tipo II, mentre Vieta e coll (2002) nel BD a cicli rapidi. La capacità della QTP di revertire la sintomatologia depressiva è di particolare rilevanza clinica in quanto la presenza di tali sintomi, più che dei sintomi positivi, può deteriorare la qualità della vita dei pazienti schizofrenici nella fase non acuta della malattia. Inoltre, ulteriori evidenze a favore dell'efficacia della QTP come agente stabilizzante dell'umore, potrebbero estendere le indicazioni per l'uso terapeutico di tale farmaco dai disordini dello spettro schizofrenico al trattamento acuto e profilattico della mania e della depressione. A tutt'oggi non esistono in letteratura studi preclinici che dimostrano l'efficacia della QTP in modelli animali di depressione. Il lavoro sperimentale oggetto della presente tesi colma in parte questa lacuna e rappresenta un' importante indicazione in tal senso, in quanto la QTP si è dimostrata capace di contrastare l'anedonia indotta nel ratto dalla somministrazione cronica di blandi stimoli stressogeni. La dose attiva di QTP (2 mg/kg/die, equivalente a circa 160 mg/die nell'uomo), è compresa nella parte bassa del range di dosi terapeutiche consigliate per il trattamento della schizofrenia e della mania in fase acuta (150-750 mg/die).

In un precedente lavoro, Kapur e coll. (2003) hanno voluto porre l'accento sulle differenze tra uomo e roditore per ciò che riguarda la farmacocinetica della QTP, sottolineando come nel roditore l'emivita degli antipsicotici atipici sia 4 - 6 volte più breve rispetto all'uomo. Di conseguenza, secondo gli autori, gli studi su roditori effettuati con protocolli di somministrazione cronica non sarebbero omologabili alla condizione clinica, in quanto si raggiungerebbero livelli plasmatici troppo bassi di farmaco. Per ciò che riguarda la QTP, i livelli plasmatici misurati nel roditore sarebbero 50-100 volte più bassi rispetto all'uomo e questo comporterebbe da parte della QTP una percentuale di occupazione dei recettori D2 dopaminergici trascurabile a dosi comprese nel range terapeutico. Tuttavia, rispetto ai recettori D2, la QTP ha affinità decisamente superiore nei confronti dei recettori α1-adrenergici (100 volte), α2-adrenergici (10 volte), H1 istaminergici (50 volte) e 5-HT2A serotoninergici (25 volte) e, di conseguenza, le considerazioni di Kapur e coll. (2003) si possono ritenere valide soprattutto per gli effetti antidopaminergici (il blocco D2 nelle aree sottocorticali è responsabile dell'effetto antipsicotico) e non per l'effetto antidepressivo, al quale il blocco dei recettori D2 partecipa solo in modo trascurabile.

Come prevedibile, anche la AMI alla dose di 2 mg/kg/die è in grado di contrastare l'anedonia causata dallo stress cronico. La potenza della QTP e della AMI nel modello CMS sembra essere equivalente, in quanto al termine della sesta settimana di trattamento, nei ratti sottoposti al protocollo CMS entrambi i farmaci riportano il consumo di saccarosio a livelli basali. Rispetto al composto triciclico, tuttavia, la comparsa dell'effetto antidepressivo della QTP richiede una settimana in più di trattamento. La presenza di un tempo di latenza di almeno 4 settimane per la comparsa dell'effetto sembrerebbe escludere un meccanismo "sinaptico" e potrebbe invece sottendere un meccanismo d'azione per la QTP simile a quello ipotizzato per le più importanti classi di antidepressivi e di stabilizzanti dell'umore, vale a dire modificazioni a lungo termine delle vie di trasduzione del segnale, dei livelli di neurotrofine e, in ultimo, dei processi plasticità neuronale.

Una prima importante conferma di questa ipotesi deriva dall'analisi dei risultati del DNA array, che ha consentito di valutare le modificazioni della regolazione genica nella corteccia frontale di ratti naive, anedonici e di ratti anedonici trattati con QTP. Apparentemente, sembrano infatti coinvolti nella comparsa dell'anedonia, uno dei sintomi cardine della depressione, alcuni geni che regolano l'apoptosi e i fenomeni di adesione cellulare, geni coinvolti nell'omeostasi del calcio intracellulare e numerosi fattori di trascrizione. Il DNA array è però una tecnica soggetta, come è noto, a possibili errori nell'interpretazione dei dati; risultati falsi positivi o falsi negativi sono probabili. Il protocollo CMS utilizzato in questo lavoro è sicuramente riconducibile ad una situazione di questo tipo, in quanto si basa sulla somministrazione quotidiana di stimoli molto blandi, anche se ripetuti per diverse settimane. E' prevedibile che queste condizioni, tutt'altro che estreme, provochino reazioni adattative appena rilevabili nel genoma delle cellule nervose, al contrario di quanto succede per esempio in seguito all'applicazione di uno stimolo stressogeno molto intenso come lo stress da costrizione (2-8 ore al giorno) ripetuto per 14 giorni (Kyoung-Shim e Pyung-Lim, 2006). La fase successiva del lavoro oggetto di questa tesi è stata perciò dedicata alla validazione dei risultati del DNA array mediante RT-PCR semiquantitativa e real time RT-PCR quantitativa. Sono stati scelti a tal proposito alcuni geni coinvolti nei processi apoptotici (Bax, Bad, Bcl2, Bcl2l1, Ebag9, Tieg, Sgk, Stk17b) e di adesione cellulare (Itga6, Itgam, Cdh1, Cdh7, Cdh22, Nlgn3, Hes5, Cldn10) regolati in modo eterogeneo (up- o down-regolati solo in un gruppo o in più gruppi) nel DNA array. Il confronto dei risultati ottenuti con le tre diverse metodiche indica una completa corrispondenza nella regolazione per Bcl2 e Stk17b (non regolati dallo stress, up-regolati da QTP), Tieg e Cdh7 (up-regolati dallo stress, down-regolati da QTP), Itgam (non regolato dallo stress, down-regolato da QTP), Itga6 (down-regolato dallo stress, non regolato da QTP). Una parziale correlazione tra i risultati è stata invece ottenuta per Bad, Cdh22 e Nlgn3 (down-regolati da QTP), Bax, Cldn10, Hes5 e Sgk (up-regolati da QTP) e Bcl2l1 (down-regolato dallo stress). Ebag9 e Cdh1 possono essere considerati falsi positivi in tutte le condizioni sperimentali prese in esame.

La famiglia di proteine Bcl2 regola l'apoptosi controllando la permeabilità della membrana mitocondriale e il rilascio del citocromo C. Le proteine anti-apoptotiche Bcl2 e Bcl-XL (prodotto del gene Bcl2l1) risiedono sulla membrana esterna mitocondriale ed inibiscono la liberazione del citocromo C dal mitocondrio. Le proteine pro-apoptotiche Bad, Bid, Bax e Bim sono citosoliche e, in seguito a segnali apoptotici, traslocano sui mitocondri dove promuovono il passaggio del citocromo C nel citoplasma. Nel citosol il citocromo C lega Apaf1 e forma un complesso di attivazione con la caspasi 9, una proteasi a cisteina, innescando il processo apoptotico. L'attività anti-apoptotica di Bcl2 è legata alla formazione di omodimeri mediante il dominio N-terminale BH4. Bcl2 però può essere parte anche di eterodimeri, in cui il secondo partner è spesso Bax. Il legame di Bax con Bcl2 impedisce la formazione degli omodimeri. A sua volta Bax può eterodimerizzare con altre proteine correlate a Bcl2. L'attività anti-apoptotica, che risiede nella presenza di omodimeri di Bcl2, è quindi il risultato di un delicato equilibrio di interazioni proteina/proteina in cui Bax funge da ligando comune. Una riduzione dell'espressione di Bax o un aumento dell'espressione di proteine correlate a Bcl2 che legano Bax, portano ad un aumento della quota libera di Bcl2 e quindi a maggiore probabilità di formazione di dimeri Bcl2 in grado di svolgere funzione anti-apoptotica. Per la sopravvivenza delle cellule è perciò di vitale importanza il rapporto tra la concentrazione di proteine pro- ed anti-apoptotiche. I nostri risultati per ciò che riguarda il bilancio complessivo della regolazione dei geni coinvolti nell'apoptosi, indica che lo stress cronico up-regola la trascrizione di Tieg (pro-apoptotico) e riduce la trascrizione di Bcl2l1 (anti-apoptotico), ma non ha effetto su Bcl2 e Bax. La QTP annulla l'effetto dello stress su Tieg, ma sembra aumentare la trascrizione di Bax (pro-apoptotico). Tale effetto è ampiamente bilanciato dalla down-regolazione di Bad (pro-apoptotico) e dalla up-regolazione di Bcl2 (anti-apoptotico). Valutando semplicemente il rapporto tra stimoli pro- e anti-apoptotici nel piccolo campione di geni presi in esame sembra dunque che il protocollo CMS tenda a spostare l'equilibrio verso la morte programmata e che la QTP possegga proprietà anti-apoptotiche/neuroprotettive. Questa osservazione è in completo accordo con i risultati di Wei e coll. (2003), che hanno osservato una azione protettiva di QTP ed altri antipsicotici atipici nei confronti dell'apoptosi indotta da ß-amiloide (25-35) in cellule della linea PC12. Risultati simili sono stati ottenuti in condizioni sperimentali differenti da Qing e coll. (2003). E' chiaro che gli effetti dello stress cronico e del trattamento con QTP ottenuti nel lavoro oggetto di questa tesi dovranno essere confermati, per esempio, valutando anche i livelli di proteine pro- e anti-apoptotiche e la loro localizzazione intracellulare (citoplasmatica o mitocondriale) nelle diverse condizioni sperimentali.

Nel cervello adulto, una caratteristica peculiare del giro dentato dell'ippocampo è la neurogenesi la quale, associata all'apoptosi, conduce ad un rapido turnover delle cellule neuronali in questa regione del SNC. Le cellule in proliferazione migrano dalla zona subgranulare dell'ippocampo allo strato delle cellule granulari dove danno origine a neuroni maturi. La neurogenesi ippocampale è stata dimostrata in numerose specie animali, uomo compreso, ed è regolata da segnali endogeni ed esogeni di vario tipo. Per esempio, è stato dimostrato che l'esposizione ad uno stress acuto o ad uno stress cronico può sopprimere la proliferazione e la sopravvivenza delle cellule granulari del giro dentato (Czèh e coll. 2002; Pham e coll. 2003; Heine e coll. 2004).

Negli ultimi anni, numerosi autori hanno avanzato l'ipotesi che alterazioni della neurogenesi siano coinvolte nell' eziopatogenesi del DDM (Jacobs e coll. 2000; Eisch. 2002; Kempermann e Kronenberg, 2003). La dimostrazione che il trattamento cronico con litio e antidepressivi e la terapia elettroconvulsiva sono in grado di stimolare la neurogenesi nel giro dentato sembrano rafforzare questa ipotesi (Chen e coll. 2000; Malberg e coll. 2000; Scott e coll. 2000).

Tuttavia, il significato e l'importanza funzionale dei neuroni generati nell'ippocampo e il ruolo che l'arresto della plasticità neuronale nel giro dentato possano avere nei disturbi dell'umore, è ancora oggi oggetto di acceso dibattito nella comunità scientifica.

Studi di imaging cerebrale effettuati nell'uomo hanno anche rivelato che l'ippocampo può subire una riduzione del proprio volume in malattie stress-correlate come, ad esempio, il DDM (Sheline e coll. 2003). Uno studio analogo, effettuato nei primati, ha confermato che lo stress cronico provoca una riduzione delle dimensioni dell'ippocampo e che questo effetto è prevenuto dal trattamento con antidepressivi (Czèh e coll. 2001).

I meccanismi responsabili della perdita di volume dell'ippocampo non sono affatto chiari, dal momento che studi post-mortem effettuati in cervelli di pazienti affetti da DDM non hanno dimostrato una perdita netta di neuroni nell'area in questione. In più, nel DDM fenomeni apoptotici sono stati descritti solo in misura limitata in alcune regioni come la corteccia entorinale e il subiculum (Lucassen e coll. 2001; Muller e coll. 2001).

Nel complesso, gli studi precedentemente descritti non hanno chiarito il ruolo che la neurogenesi e la morte neuronale programmata possono rivestire nel danno provocato dallo stress nel cervello adulto e nella comparsa di malattie di interesse psichiatrico come i disturbi dell'umore.

E' certo che l'apoptosi e una perdita netta di neuroni sono dimostrabili nel tessuto cerebrale dell'animale da esperimento solo in situazioni di stress molto intenso e prolungato, che sicuramente non riproducono fedelmente le condizioni proprie della patologia umana. Al contrario, è probabile che nelle aree cerebrali coinvolte nella patogenesi dei disturbi affettivi (corteccia prefrontale, amigdala, ippocampo) si verifichino variazioni dei meccanismi regolatori dell'apoptosi, non sufficienti ad indurre direttamente la morte neuronale, ma capaci di alterare il delicato equilibrio intracellulare tra fattori pro- ed anti-apoptotici. I risultati ottenuti con il lavoro sperimentale oggetto di questa tesi sembrano in linea con questa ipotesi e possono rappresentare un iniziale contributo all'identificazione dei bersagli sensibili all'azione dello stress cronico (e dei farmaci stabilizzanti dell'umore come QTP) nei processi apoptotici.

Per quanto riguarda la regolazione dei geni coinvolti nell'adesione cellulare, i risultati del DNA array indicano complessivamente che lo stress cronico up-regola Cdh7, riduce la trascrizione del gene Itga6, ma non ha effetto su Itgam. La QTP annulla l'effetto dello stress su Cdh7, sembra diminuire la trascrizione di Itgam, Cdh22, Nlgn3 e up-regola Hes5 e Cldn10.

Le caderine partecipano alla formazione delle giunzioni aderenti, siti di interazione tra cellule, implicati non solo nella formazione di parenchimi e superfici mucose, ma anche dell'organizzazione dei contatti sinaptici. Esse si associano a formare omodimeri che interagiscono con caderine dello stesso tipo espresse da cellule omologhe. Le interazioni mediate dalle caderine sono strettamente dipendenti da ioni calcio che si legano alla molecola. Nel versante intracellulare esse si associano ad altre proteine (catenine) e al citoscheletro. Il complesso caderine-catenine-actina e altre proteine citoscheletriche (α-actinina) permette l'ancoraggio delle caderine nel loro versante citoplasmatico e funge da nucleo di aggregazione per altre molecole di segnale che regolano diverse funzioni cellulari. Oltre che interagire tra loro, le cellule aderiscono al tessuto interstiziale o a membrane basali, strutture che nel loro insieme vengono considerate matrice extracellulare. L'adesione alla matrice extracellulare è prevalentemente mediata da integrine. Le integrine sono eterodimeri costituiti dall'associazione non covalente tra una catena α e una catena ß e vengono classificate in diverse sottofamiglie in base alla struttura della catena ß. Membri delle sottofamiglie ß1, ß3, ß4, ß5, ß6 e ß8 riconoscono proteine della matrice extracellulare quali collagene, fibronectina, vitronectina, laminina ed entactina. In letteratura, le notizie sulla regolazione e sulle funzioni specifiche di Cdh7, la cui trascrizione è aumentata dallo stress cronico e riportata ai livelli basali dal trattamento con QTP nelle nostre condizioni sperimentali, sono scarse (Kawano e coll. 2002) e non consentono una interpretazione soddisfacente dei risultati ottenuti. Le stesse considerazioni valgono per il gene Itga6, down-regolato dallo stress cronico. Di tutt'altro interesse potrebbe essere invece il dato relativo alla up-regolazione del gene Hes5 da parte della QTP. La proteina Hes5 è un fattore di trascrizione che, assieme a NUDR, regola negativamente l'espressione del recettore 5-HT1A serotoninergico. Il recettore 5-HT1A è un recettore somatodendritico con funzioni inibitorie sul firing dei neuroni serotoninergici dei nuclei del rafe ed è perciò considerato l'effettore della modulazione negativa delle vie serotoninergiche nel SNC. La riduzione della funzione serotoninergica, come è noto, è ritenuta in parte responsabile della patogenesi dei disturbi dell'umore e un aumento della densità dei recettori 5-HT1A nei nuclei del rafe è stato dimostrato in studi post-mortem effettuati sul cervello di pazienti depressi (Stockmeier e coll. 1998). Inoltre, molti farmaci in grado di contrastare i sintomi dell'ansia e della depressione, compresa la QTP, sono bloccanti o agonisti parziali del recettore 5-HT1A. I risultati ottenuti con il lavoro oggetto di questa tesi sembrano dimostrare che la QTP, oltre all'effetto recettoriale, possegga anche la capacità di aumentare la regolazione del gene Hes5, e ,quindi, di diminuire l'espressione e la densità dei recettori 5-HT1A serotoninergici.

BIBLIOGRAFIA

  • Altamura A.C., Salvadori D., Madaro D., Santini A., Mundo E., 2003. Efficacy and tolerability of quetiapine in the treatment of bipolar disorder: preliminary evidence from a 12-month open-label study. J Affect. Disord. 76, 267-71.
  • American Psychiatric Association, 1994. Diagnostic and Statistical Manual of Mental Disorders (4th edn), American Psychiatric Press.
  • Ayensu W.K., Pucilowski O., Mason G.A., Overstreet D.H. Rezvani A.H., Janowsky D.S., 1995. Effects of chronic mild stress on serum complement activity, saccharin preference and corticosterone levels in Flinders lines of rats. Physiol. Behav. 57, 165-169.
  • Backer R., Ames D., Umbricht D., Chengappa K.N.R., Schooler N.R. 1995. Olanzapine's impact on depressive and obsessive-compulsive symptoms in schizophrenia. Psychopharmacol. Bull. 31, 549.
  • Baldessarini R.J., Frankenburg F.R., 1991. Clozapine: a novel antipsychotic agent. N. Engl. J. Med. 324, 746-54.
  • Banov M.D., Zarate C.A.Jr., Tohen M., Scialabba D., Wines J.D.Jr., Kolbrener M. et al., 1994. Clozapine in refractory affective disorders:polarity predicts response in long-term follow-up. J. Clin. Psychiatry. 155, 295-300.
  • Barkin J.S. & Pais V.M., 1997. Induction of mania by risperidone resistant to mood stabilizer. J. Clin. Psychopharmacol. 17, 56-7.
  • Bates K.S., Boehringer K.L., Syed A., 1999. Olanzapine response in psychotic depression. J. Clin. Psychiatry 60, 116-8.
  • Battegay R., Cotar B., Fleishenhauer J., Rauchfleish U., 1977. Results and side effects of treatment with clozapine. Comp. Psychiatry 18, 423-42.
  • Berk M., Ichim L., Brook S., 1999. Olanzapine compared to lithium in mania:a double blind randomized controlled trial. Int. Clin. Psychopharmacol. 14, 339-43.
  • Bissette G., 2001. Effect of sertraline on regional neuripeptide concentrations in olfactory bulbectomized rats. Pharmacol. Biochem. Behav. 69, 269-281.
  • Blier, P., de Montigny, C., Chaput, Y., 1987. Modifications of the serotonin system by antidepressant treatments: implications for the therapeutic response in major depression. J. Clin. Psychopharmacol. 7, 24S-35S.
  • BLier, P., de Montigny, C., 1994. Current advances and trends in the treatment of depression. Trends Pharmacol. Sci. 15, 220-226.
  • Borsini F. e Meli A., 1998. Is the forsed swimming test a suitable model for revealing antidepressant activity?. Psycopharmacology Berl. 94, 147-160.
  • Bristow L.J., Kramer M.S., Kulagowski J., Patel S., Ragan C.I., Seabrook G.R., 1997. Schizophrenia and L-745, 870, a novel dopamine D4 receptor antagonist. Trends Pharmacol. Sci. 18, 186-8.
  • Calabrese J.R., Kimmel S.E., Woyshville M.J., Rappaport D.J., Faust C.J., Thompson P.A., et al., 1996. Clozapine for treatment refractory mania. Am. J. Psychiatry 153, 759-764.
  • Calabrese J.R Keck P.E.Jr Macfadden W Minkwitz M Ketter T.A Weisler R.H Cutler A.J McCoy R Wilson E Mullen J., 2005. A randomized, double-blind, placebo-controlled trial of quetiapine in the treatment of bipolar I or II depression. Am. J. Psychiatry 162, 1351-60.

Centorrino F., Baldessarini R.J., Kando J., Frankenburg F.R., Volpicelli S.A., Puopolo P.R., et al.' 1994. Serum concentrations of clozapine and its major metabolites: effects of co-treatment with fluoxetine or valproate. Am. J. Psychiatry 151, 123-5.

Cheeta S., Broekkamp C., Willner P., 1994. Stereospecific reversal of stress-induced anhedonia by mianserin and its (+)-enantiomer. Psychopharmacology 116, 523-528.

Cheeta S., 1995. A model of depression: assessment of the validity of the chronic mild stress procedure. Ph.D. thesis, University of Wales.

Cheeta, S., Ruigt, G., van Proosdij, J., Willner, P., 1997. Changes in sleep architecture following chronic mild stress. Biol. Psychiatry 41, 419-427.

Chen, G., Rajkowska, G., Du, F., Seraji-Bozorgzad, N., Manji, H.K., 2000. Enhancement of hippocampal neurogenesis by lithium. J. Neurochem. 75, 1729-1734.

Connor T.J. e al., 1999. Stressor-induced alterations in serotoninergic actyvity in animal model of depression. NeuroReport 10, 523-528.

Coryell, W.,Endicott, J., Keller, M., 1992. Rapidly cycling affective disorder: demographics, diagnosis, family history and course. Arch. Gen. Psychiatry 49, 126-131.

  • Costello L., Suppes T., 2000. A clinically significant interaction between clozapine and valproate. J. Clin. Psychopharmacol. 15, 39-40.
  • Crawley J.N., 1984. Evaluation of a proposed hamster separation model of depression. Psychiatry Res. 11, 35-47.
  • Crawley J.N., 1985. A monoamine oxidase inhibitor reverses the "separation sundrome" in a new hamster separation model of depression. Eur. I. Pharmacol. 129-133.
  • Crawley J.N., Sutton M.E., Pickar D., 1985. Animal models of self-destructive behavior and suicide. Psychiatr. Clin. North Am. 8, 299-310.
  • Crossin K.L., Krushel L.A., 2000. Cellular signaling by neuronal cell adhesion molecules of the immunoglobulin superfamily. Dev. Dyn. 21, 8260-8279.
  • Cryan J.F. e coll, 1998. Combining pindolol and paroxetine in animal model of chronic antidepressant action can early onset of action be detected?. Eur. J. Pharmacol. 352, 23-28.
  • Cryan J.F.e Lucki I., 2000. Antidepressant-like behavioural effects mediated by 5-hydroxytryptamine receptors. J. Pharmacol. Exp. Ther. 295, 1120-1126.
  • Cryan J.F., Markou A. and Irwin Lucki, 2002. Assessing antidepressant activity in rodens: recent developments and future needs. Review trends in Pharmacological. Sciences, vol.23, num.5 may 2002, 238-244.
  • Czéh, B., Michaelis, T., Watanabe, T., Frahm, J., de Biurrun, G., van Kampen, M., Bartolomucci, A., Fuchs, F., 2001. Stress-induced changes in cerebral metabolites, hippocampal volume and cell proliferation are prevented by antidepressant treatment with tianeptine. Proc. Natl. Acad. Sci. U. S. A. 98, 12796-12801.
  • Czéh, B., Welt, T., Fischer, A.K., Erhardt, A., Schmitt, W., Muller, M., 2002. Chronic psychosocial stress and concomitant repetitive trans-cranial magnetic stimulation: effects on stress hormone levels and adult hippocampal neurogenesis. Biol. Psychiatry 52, 1057-1065.
  • D'Aquila P., Brain P.F., Willner P., 1994. Effect of chronic mild stress in behavioural tests revelant to anxiety and depression. Physiol.Behav. 62, 421-426.
  • Daskalakis Z., Christensen B., Zipursky R., Zhang-Wong J., Beiser M., 1998. Relationship between D2 occupancy and prolactin levels in first episode psychosis. Biol. Psychiatry 43, 113S.
  • Diaz S.F., 1996. Mania associated with risperidone. J. Clin. Psychiatry 57, 41-2.
  • Duman R.S., Heninger G.R. e Nestler E.J., 1997. A molecular and cellular theory of depression. Archives of General. Psychiatry 54, 597-606.
  • Duman R.S., 1998. Novel therapeutic approaches beyond the 5-HT receptor. Biol. Psychiatry 44, 324-335.
  • Duman R.S., Malberg J., Thome J., 1999. Neuronal plasticity to stress, antidepressant treatment. Biol. Psychiatry 46, 1181-1191.
  • Dwight M.M., Keck P.E.Jr., Stanton S.P., Strakowski S.M., McElroy S.L., 1994. Antidepressant activity and mania associated with risperidone treatment of schizoaffective disorder. Lancet 344, 554-5 (letter).
  • Ertugrul A., Meltzer H.Y., 2003. Antipsychotic drugs in bipolar disorder. Int. J. Neuropsychopharmacol.  6, 277-84.
  • Farde L., Nordstrom A.L., Wiesel F.A., Pauli S., Halldin C., Sedvall G., 1992. Positron emission tomographic analysis of central D1 and D2 dopamine receptor occupancy in patients treated with classical neuroleptics and clozapine: relation to extrapyramidal side effects. Arch. Gen. Psychiatry 49, 538-44.
  • Fawcett J., Clark D.C., Scheftner W.A., Gibbons R.D., 1983. Assessing anhedonia in psychiatric patients. The pleasure scale. Arch. Gen. Psychiatry 40, 79-84.
  • Frazier J.A., Biederman J., Tohen M., Feldman P.D., Jacobs T.G., Toma V. et al., 2001. A prospective open-label treatment trial of olanzapine monotherapy in children and adolescents with bipolar disorder. J. Child. Adolesc. Psychopharmacol. 11, 239-50.
  • Gershon, E.S., Berrettini, W., Numberger, J.I., Goldin, L.R., 1987a. Genetics of affective illness. In: Meltzer, H.Y. Ed., Psychopharmacology: The Third Generation of Progress. Raven, New York, 481-492.
  • Gershon, E.S., Hamovit, J.H., Guroff, J.J., Nurnberger, J.I., 1987b. Birth-cohort changes in manic and depressive disorders in relatives of bipolar and schizoaffective patients. Arch. Gen. Psychiatry 44, 314-319.
  • Ghaemi S.N., Sachs G.S., Baldassano C., Truman C., 1997. Acute treatment of bipolar disorder with adjunctive risperidone in outpatients. Can. J. Psychiatry 42, 196-9.
  • Ghaemi S.N., Katzov J.J., 1999. The use of quetiapine for treatment-resistant bipolar disorder: a case series. Ann. Clin. Psychiatry 11, 137-40.
  • Ghosh A., Carnahan J., Greenberg M.E., 1994. Requirement for BDNF in activity-dependent survival of cortical neurons. Science 263, 1618-1623.

Gonzalez-Pinto A., Lalaguna B., Mosquera F., Perez de Heredia J.L., Gutierrez M. et al., 2001. Use of olanzapine in dysphoric mania. J. Affect. Disord. 66, 247-53.

  • Goodnick P.J., 1995. Risperidone treatment of refractory acute mania. J. Clin. Psychiatry 56, 431-2.
  • Goodwin F.K., Jamison K.R., 1990. Manic-depressive Illness. New York, Oxford University Press.
  • Gorka Z., Morly E., Papp M., 1996. The effect of chronic mild stress on circadian rhythms in the locomotor activity of rats. Pharmacol. Biochem. Behav. 54, 229-234.
  • Graham S.R., Kokkinidis L., 1993. Clozapine inhibits limbic system kindling:implications for antipsychotic action. Brain Res Bull. 30, 597-605.
  • Hall H., Carbonneto S., Schachnre M., 1997. L1/HNH-1 carbohydrate- and beta(1) integrin-dependent neuronal cell adhesion to laminin-1. J. Neurochem. 68, 544-553.
  • Hall H., Bozic D., Fause C., Engel J., 2000. Trimerization of cell adhesion molecule L1 mimics clustered L1 expression on the cell surface on L1-ligand interactions and on promotion of neurite outgrowth. J. Neurochem. 75, 336-346.
  • Heine, V.M., Maslam, S., Zareno, J., Joëls, M., Lucassen, P.J., 2004a. Suppressed proliferation and apoptotic changes in the rat dentate gyrus after acute and chronic stress are reversible. Eur. J. Neurosci. 19, 131-144.
  • Heinrich K., Klieser E., Lehmann E., Kinzler E., Hruschka H., 1994. Risperidone vs. clozapine in the treatment of schizophrenic patients with acute symptoms:a double blinde, randomized, trial. Prog. Neuropsychopharmacol. 18, 127-37.
  • Hillert A., Maier W., Wetzel H., Benkert O., 1992. Risperidone in the treatment of disorders with a combined psychotic and depressive syndrome - a functional approach. Pharmachopsychiatry 25, 213-7.
  • Hippius H., 1989. The history of clozapine. Psychopharmacolgy 99, S3-S5.
  • Ho Y.J. e al., 2000. Striatal glutamate release durino novelty exposure-induced hyperactivity in olfactory bulbectomized rats. Neurosci. Lett. 287, 117-120.
  • Holmes P.V. e coll., 1998. Effect of olfactory bulbectomy on neuropeptide gene expression in the rat olfacory/limbic system. Neuroscience 86, 587-596.
  • Jacobs, B.L., Praag, H., Gage, F.H., 2000. Adult brain neurogenesis and psychiatry: a novel theory of depression. Mol. Psychiatry 5, 262-269.
  • Janicak P.G., Keck P.E.Jr., Davis J.M., Kasckow J.W., Tugrul K., Dowd S.M. et al., 2001. A double-blind, randomized, prospective evaluation of the efficacy and safety of risperidone versus haloperidol in the treatment of schizoaffective disorder. J. Clin. Psychopharmacol. 21, 360-8.
  • Jones C., Kapur S., Remington G., Zipursky R.B., 2000. Transient dopamine D2 occupancy in low EPS-incidence drugs: PET evidence. Biol. Psychiatry 47 (8 suppl), 112.
  • Junghan U., Albers M., Woggon B., 1993. Increased risk of hematological side-effects in psychiatric patients treated with clozapine and carbamazepine? Pharmacopsychiatry 26, 262 (letter).
  • Kandel E.R., Schwantz J.H., Jessel T.M., 1994. Principi di neuroscienze. Casa ed. Ambrosiana II ed.
  • Kando J.C., Tohen M.,Castillo J., Centorrino F., 1994. Concurrent use of clozapine and valproate in affective and psychotic disorders. J. Clin. Psychiatry 55, 255-7.
  • Kane J., Honigfeld G., Singer J., Meltzer H., Clozaril Collaborative Group, 1988. Clozapine for treatment resistant schizophrenia. A double-blind comparison with chlorpromazine. Arch. Gen. Psychiatry 45, 789-96.
  • Kapur S., Zipursky R., Remington G., Jones C., McKay G., Houle S., 1997. PET evidence that loxapine is an equipotent blocker of 5-HT2 and D2 receptors:implications for the treatment of schizophrenia. Am. J. Psychiatry 154, 1525-9.
  • Kapur S., Zipursky R.B., Remington G., Jones C., DaSilva J., Wilson A.A. et al., 1998a. 5-HT2 and D2 receptor occupancy of olanzapine in schizophrenia:a PET investigation. Am. J. Psychiatry 155, 921-8.
  • Kapur S., Zipursky R.B., Remington G., 1999. Clinical and theoretical implications of 5-HT2 and D2 receptor occupancy of clozapine, risperidone, and olanzapine in schizophrenia. Am. J. Psychiatry 156, 286-93.
  • Kapur S., Zipursky R., Jones C., Shammi C.S., Remington G., Seeman P., 2000. A positron emission tomography study of quetiapine in schizophrenia:a preliminary finding of an antipsychotic effect with only transiently high dopamine D2 receptor occupancy. Arch. Gen. Psychiatry 57, 553-9.
  • Kapur S., Vanderspek S.C., Brownlee B.A., Nobrega J.N., 2003. Antipsychotic dosing in preclinical models is often unrepresentative of the clinical condition: a suggested solution based on in vivo occupancy.  J. Pharmacol. Exp. Ther. 305, 625-31.
  • Karin M., Hunter T., 1995. Transcriptional control by protein phosphorylation. Signal transmission from the cell surface to the nucleus. Curr. Biol. 5, 747-757.
  • Katz R., Roth K.A., Carrol B.J., 1981. Acute and chronic stress effects on open field activity in the rat; implication for a model of depression. Neurosci. Biobehav. Rev. 5, 247-251.
  • Katz R., 1982. Animal model of depression: pharmacological sensivity of hedonic deficit. Pharmacol. Biochem. Behav. 16, 965-968.
  • Kawano R., Matsuo N., Tanaka H., Nasu M., Yochioka H., Shirabe K., 2002. Identification and characterization of a soluble cadherin-7 isoform produced by alternative splicing.  J. Biol. Chem. 277, 47679-47685.
  • Keck P.E.Jr., Wilson D.R., 1995. Clinical predictors of acute risperidone response in schizophrenia, schizoaffective disorder and psychotic mood disorder. J. Clin. Psychiatry 56, 466-71.
  • Keck P.E.Jr., McElroy S.L., Strakowski S.M., Stanton S.P., Kizer D.L., Balistreri T.M. et al., 1996. Factors associated with maintenance antipsycotic treatment of patients with bipolar disorder. J. Clin. Psychiatry 57, 147-51.
  • Kehoe, P., Shoemaker, W.J., Triano, L., Callahan, M., Rappolt, G., 1998. Adult rats stressed as neonates show exaggerated behavioral responses to both pharmacological and environmental challenges. Behav. Neurosci. 112, 1116- 11125.
  • Kelly J.P. e coll, 1997. The olfactory bulbectomized rat as a moidel of depression: an update. Pharmacol. Ther. 74, 299-316.
  • Kempermann, G., Kronenberg, G., 2003. Depressed new neurons - adult hippocampal neurogenesis and a cellular plasticity hypothesis of major depression. Biol. Psychiatry 54, 499-503.
  • Kubera M., Basta-Kaim A., Papp M., Skowron-Cendrzak A., 1994. Immunological changes after chronic mild stress and psychotropic drugs administration. Abstracts, 12th European Immunology Meeting, 37.
  • Kubera M., Basta-Kaim A., Papp M., 1995. The effect of   chronic treatment with imipramine on the immunoreactivity of animals subjected to chronic mild tress model of depression. Immunopharmacology 30, 225-230.
  • Kyoung-Shim K. e Pyung-Lim H., 2006. Optimization of chronic stress paradigms using anxiety- and depression-like behavioral parameters. J. Neurosci. Res. 83, 497-507.
  • Laifenfeld D., Karry R., Grauer E., Klein E., Ben-Shachar D., 2002a. Antidepressant and stress modulat the expression and protein levels of two genes involved in neuronal plasticity, CAM-L1 and laminin in rat brain. Israel. J. Psychiatry 39, 36.
  • Laifenfeld D., Klein E., Ben-Shachar D., 2002b. Norepinephrine alters the expression of genes involved in neuronal sprouting anf differentiation: revelance for major depression and antidepressant mechanisms. J. Neurochem. 83, 1054-1064.
  • Laifenfeld D., Karry R., Grauer E., Klein E., Ben-Shachar D., 2005. Alteration in cell adhesion molecule L1 and functionally related genes in major depression: a postmortem study. Biol. Psychiatry 57, 716-725.
  • Lanfuney, L., La Cour, C.M., Frogger, N., Hamon, M., 2000. 5-HT-HPA interactions in two models of transgenic mice relevant to major depression. Neurochem. Res. 25, 1199-1206.
  • LeDoux J., 1996. The Emotional Brain. New York: Simon and Schuster.
  • Leppig M., Bosch B., Naber D., Hippius H., 1989. Clinical managment of clozapine patients in relation to efficacy and side-effects. Brit. J. Psychiatry 160, 54-9.
  • Longo L.P., Salzman C., 1995. Valproic acid effects on serum concentrations of clozapine and norclozapine. Am. J. Psychiatry 152, 650 (letter).
  • Lucassen, P.J., Muller, M.B., Hoisboer, F., Bauer, J., Holtrop, A., Wouda, J., 2001a. Hippocampal apoptosis in major depression is a minor event and absent from subarcas at risk for glucocorticoid overexposure. Am. J. Pathol. 158, 453-468
  • Lucki I. 1997. The forsed swimming test as a model for core and component behavioural effect of antidepressant drugs. Behav. Pharmacol. 8, 523-532.
  • Luthl A., Laurent J.P., Figurov A., Muller D., Schachner M., 1994. Hippocampal long-term potentiation and neuronal adhesion molecules L1 e NCAM. Nature 27, 2777-2779.
  • Madhusoodanan S., Brenner R., Alcantra A., 2000. Clinical experience with quetiapine in elderly partients with psychotic disorders. J. Geriatr. Psychiatry Neurol. 13, 28-32.
  • Malberg, J.E., Eisch, A.J., Nestler, E.J., Duman, R.S., 2000. Chronic antidepressant treatment increases neurogenesis in adult rat hippocampus. J. Neurosci. 20, 9104-9110.
  • Mann, J.J., 1999. Role of the serotonergic system in the pathogenesis of major depression and suicidal behavior. Neuropsychopharmacology (2), (Suppl) 99S-105S.
  • Manji, H.K. & Lenox, R.H., 2000. Signaling: Cellular insights into the pathophysiology of bipolar disorder. Biol. Psych. 48, 518-530.
  • Manji, H.K., Moore, G.J., Rajkowska, G. & Chen, G., 2000. Neuroplasticity and cellular resilience in mood disorders. Millennium article. Mol. Psychiatry 5, 578-593.
  • Mar A. e coll., 2000. Antidepressants preferentially enhance habituation to novelty in the olfactory bulbectomized rat. Psycopharmacology Berl. 150, 52-60.
  • Martinot J.L., Trichard C., Paillere-Martinot M.L., Attar-Levy D., Recassens C., Monnet F., 1998. Binding of antipsychotic drugs to cortical 5-HT2A receptors: a PET study of chlorpromazine, clozapine, and amisulpride in schizophrenic patients. Am. J. Psychiatry. 155, 505-8.
  • McElroy S.L., Dessain E.C., Pope H.G., Cole J.O., 1991. Clozapine in the treatment of psychotic mood disorders, schizoaffective disorders and schizophrenia. J. Clin. Psychiatry 52, 411-4.
  • McElroy S.L., Keck P.E.Jr., Strakowski S.M., 1996. Mania, psychosis and antipsychotics. 57, 14-26.
  • McElroy S.L., Frye M., Denicoff K., Altshuler L., Nolen W., Kupka R. et al.,1998. Olanzapine in treatment-resistant bipolar disorder. J. Affect. Disord. 49, 119-22.
  • McKinney W.T., 1988. Models of Mental Disorders: a New Comparative Psychiatry. New York, Plenum Medical Book Co.
  • McKinney W.T. e Bunney W.E., 1969. Animal model of depression. Review of evidence: implications for research. Arch. Gen. Psychiatry 21, 240-248.
  • Monleon S., D'Aquila P., Parra A., Simon V.M., Brain P.F., Willner P., 1994. Attenuation of sucrose consumption in mice by chronic Mild stress and its restoration by imipramine. Psychopharmacology 117: 453-457.
  • Moreau J.L., Jenck F., Martin J.R., Mortas P., Haefely W.E., 1992. Antidepressant treatment prevents chronic mild stress-induced anhedonia as assessed by ventral tegmentum self-stimulation behaviour in rats. Eur. Neuropsychopharmacol. 2, 43-49.
  • Moreau J.L., Jenck F., Martin J.R., Mortas P., Haefely W.E., 1993. Effects of moclobemide, a new generation reversible MAO-A inhibitor, in a novel animal model of depression. Pharmacopsychiatry 26, 30-33.
  • Moreau J.L., Jenck F., Martin J.R., Mortas P. 1994a. Curative effects of the atypical antidepressant mianserin in the chronic mild stress-induced anhedonia model of depression. J. Psychiatr. Neurosci. 19, 51-56.
  • Moreau J.L., Borgulya J., Jenck F., Martin J.R., 1994b. Tolcapone, a potential new antidepressant detected in a novel animal model of depression. Behav, Pharmacol, 5, 344-350.
  • Moreau J.L., Scherschlict R., Jenck F., Martin J.R., 1995. Chronic mild stress-induced anhedonia model of depression: sleep abnormalities and curative effects of electroshock treatment. Behav. Pharmacol. 6, 682-687.
  • Muller T, Becker T, Fritze J., 1988. Neuroleptic malignant syndrome after clozapine plus carbamazepine. Lancet 2, 1500 (letter).
  • Muller, M.B., Lucassen, P.J. Yassouridis, A., Hoogendijk, W.J., Holsboer. F. Swaab, D.F., 2001. Neither major depression nor glucocorticoid treatment affeets the cellular integrity of the human hippocampus. Eur. J. Neorosci. 14, 1603 - 1612.
  • Murphy D.L.,1977. Animal models for mania. In Hanin, E. Usdin, eds: Animal Models in Psychiatry and Neurology. New York, Pergamon Press, 211-223.
  • Muscat R., Sampson D., Willner P., 1990. Dopaminergic mechanism of imipramina action in nimal model of depression. Biol. Psychiatry 28, 223-230.
  • Muscat R., Willner P., 1992. Supression of sucrose drinking by chronic mild unpredictable stress: a methodological analysis. Neurosci. Biobehav. Rev. 16, 507-517.
  • Muscat R., Papp M., Willner P., 1992. Reversal of stress-induced anhedonia by the atypical antidepressants, fluoxetine and maprotiline. Psychopharmacology 109, 433-438.
  • Muscat R., Papp M., Willner P., 1992. Antidepressant-like actions of DA agonists in animal model of depression. Biological Psychiatry 31, 937-946.
  • Nyberg S., Farde L., Halldin C., 1997. A PET study of 5-HT2 and D2 dopamine receptor occupancy induced by olanzapine in healthy subjects. Neuropsychopharmacology 16, 1-7.
  • O'Cronin Z.T. & Holt L., 1995. Hypomania associated with risperidone. Can. J. Psychiatry 2, 51.
  • Qing H., Xu H., Wei Z., Gibson K., Xin-Min L., 2003. The ability of atypical antipsychotic drugs vs haloperidol to protect PC12 cells against MPP+ -induced apoptosis. Eur. J. Neurosci. 17, 1563-1570.
  • Paoletti R., Nicosia S., Clementi F., Fumagalli G., 1999. Farmacologia generale e molecolare. 2a ed, UTET.
  • Papp M., Willner P., Muscat R., 1991. An animal model of anhedonia: attenuation of sucrose consumption and place preference conditioning by chronic unpredictable mild stress. Psychopharmacology 104, 255-259.
  • Papp M., Lappas S., Muscat R., Willner P. 1992. Attenuation of place preference conditioning but not place aversion conditioning by chronic mild stress. J. Psychopharmacol- 6, 352-356.
  • Papp M., Moryl E., 1994. Antidepressant activity of non-competitive and competitive NMDA receptor antagonists in a chronic mild stress model of depression. Eur. J. Pharmacol. 263, 1-7.
  • Papp M., Klimek V., Willner P., 1994a. Effects of imipramine on serotonergic and beta-adrenergic receptor binding in a realistic animal model of depression. Psychopharmacology 114, 309-314.
  • Papp M., Klimek V., Willner P., 1994b. Parallel changes in dopamine D2 receptor binding in limbic forebrain associated with chronic mild stress-induced anhedonia and its reversal by imipramine. Psychopharmacology 115, 441-446.
  • Papp M., Moryl E., Willner P., 1996. Pharmacological validation of the chronic mild stress model of depression. Eur. J. Pharmacol. 296, 129-136.
  • Pavlides, C., Kimura, A., Magarinos, A.M. et al., 1995. Opposing roles of type II adrenal steroid receptors in hippocampal long-term potentiation. Neuroscience 68, 387-394.
  • Petrie, R.X., Reid, I.C., & Steward, C.A., 2000. The NMDA receptor, synaptic plasticity and depressive disorder: a critical review. Pharmacology and Therapeutics 87, 11-25.
  • Petty F., Sherman A.D.,1981. A pharmacologically pertinant animal model of mania. J. Affective Disord. 3, 381-387.
  • Pham. K., Nacher, J., Hof, P.R., McEwen, B.S., 2003. Repeated restraint stress suppresses neurogenesis and induced biphasic PSA-NCAM expression in the adult rat dentate gyrus. Eur. J. Neurosci. 17, 879-886.
  • Pletscher A., Shore P.A., and Brodie B.B., 1956. Serotonin as a mediator of reserpine action in brain. J. Pharmacol. Exp. Ther. 116, 84-89.
  • Porsolt R.D., 1997. Depression. A new animal model sensitive to antidepressant treatments. Nature 266, 730-732.
  • Porsolt R.D., 2000. Animal model of depression: utility for transgenic research. Rev Neurosci. 11, 53-58.
  • Primeaux S.D. e Holmes P.V., 1999. Role of aversively motivated behavior in the olfactory bulbectomy sindrome. Physiol. Behav. 67, 41-47.
  • Przegalinski E., Moryl E., Papp M., 1995. The effect of 5-HT1A receptor ligands in a chronic mild stress model of depression. Neuropharmacology 34, 1305-1310.
  • Raitasuo V., Lehtovaara R., Huttunen MO., 1993. Carbamazepine and plasma levels of clozapine. Am. J. Psychiatry 150, 169 (letter).

Rang H.P., Dale M.M., Ritter J.M., Moore P.K., 2005. Farmacologia. 3a edizione, ed. Ambrosiana.

  • Reid I. e Stewart C., 1997. Seizure, memory and synaptic plasticity. Seizure 6, 351-359.
  • Reid I.C. e Steward C.A., 2001. How Antidepressant Work. British journal of psychiatry 299-303.
  • Ritter J.M., Moore P.K., 2005. Farmacologia. 3a ed., ed. Ambrosiana.
  • Roose K., Gelders Y., Heylen S., 1988. Risperidone in psychotic patients:   first clinical therapeutic experience. Acta. Psychiatr. Belg. 8, 3-41.
  • Roseboom P.H., Klein D.C., 1995. Norepinephrine stimulation of pineal cyclic AMP response elment-binding protein phosphorilation: primary role of a beta-adrenergic receptor/cyclic AMP mechanism. Mol. Pharmacol. 47, 439-449.
  • Rosellini, R.A., de Cola, J.P., 1981. Inescapable shock interferes with the acquisition of a low-activity response in an appetitive context. Anim. Learn Behav. 9, 487-490.
  • Rossi F., Cuomo V., Riccardi C., 2005. Farmacologia: principi base e apllicazioni terapeutiche. Edizioni Minerva Medica, Torino.
  • Sajatovic M., Di Giovanni S.K., Bastani B., Hattab H., Ramirez L.F., 1996. Risperidone therapy in treatment refractory, acute bipolar and schizoaffective mania. Psychopharmacol. Bull. 32, 55-61.
  • Sajatovic M., Brescan D.W., Perez D.E., DiGiovanni S.K., Hattab H., Ray J.B. et al, 2001. Quetiapine alone and added to a mood stabilizer for serious mood disorders. J. Clin. Psychiatry 62, 728-32.
  • Sampson D., Willner P., Muscat R., 1991. Reversal of antidepressant action by dopamine antagonists in an animal model of depression. Psychopharmacology 104, 491-495.
  • Sanger T.M., Grundy S.L., Gibson P.J., Namjoshi M.A., Greaney M.G., Tohen M.F., 2001. Long-term olanzapine therapy in the treatment of bipolar I disorder: an open-label continuation phase study. J. Clin. Psychiatry 62, 273-81.
  • Schaaf, M.J., De Jong, J., De Kloet, R. et al., 1998. Dowregulation of BDNF mRNA and protein in the rat hippocampus by corticosterone. Brain Research 813, 112-120.
  • Scott, B.W., Wojtowics, J.M., Bumham, W.M., 2000. Neurogenesis in the dentate gyrus of the rat following electroconvulsive shock seizures. Exp. Neurol. 165, 231-236.
  • Seeman P., Van Tol H.H.M., 1994. Dopamine receptor pharmacology. Trends Pharmacol. Sci. 15, 264-70.

Seligman, M.E., Beagley, G., 1975. Learned helplessness in the rat. J. Comp. Physiol. Psychol. 88, 534-541.

  • Sernyak M.J., Godleski L.S., Griffin R.A., Mazure C.M., Woods S.W., 1997. Chronic neuroleptic exposure in bipolar outpatients. J. Clin. Psychiatry 58, 193-5.
  • Shaffer C.G. & Shaffer L.C., 1996. The use of risperidone in the treatment of bipolar disorder. J. Clin. Psychiatry 57, 136.
  • Sharma V., Pistor L., 1999. Treatment of bipolar mixed states with olanzapine. J. Psychiatr. Neurosci. 24, 40-4.
  • Sheline, Y.I., Gado, M. H., Kraemer, H.C., 2003. Untreated depression and hippocampal volume loss. Am. J. Psychiatry 160, 1516-1518.
  • Singh A.N., Catalan J., 1994. Risperidone in HIV-related main psychosis. Lancet 344, 1029-30.
  • Siuciak, J.A., Lewis, D.R., Wiegand, S.J. et al., 1997. Antidepressant-like effect of brain-derived neurotrophic factor (BDNF). Pharmacology, Biochemistry and Behavior, 56, 131-137.
  • Sluzewska A., Nowakowska E. 1994. The effects of carbamazepine, lithium and ketoconazole in chronic mild stress model of depression in rats. Behav. Pharmacol. 5 (Suppl 1), 86.
  • Sluzewska A., Szczawinska K., 1996a. Lithium potentiation of antidepressants in chronic mild stress model of depression in rats. Behav. Pharmacol. 7 (Suppl 1), 105.
  • Sluzewska A., Szczawinska K., 1996b. The effects of pindolol addition to fluvoxamine and buspirone in chronic mild stress model of depression. Behav. Pharmacol. 7 (Suppl 1), 105.
  • Smadja C., 1996. Etude pharmacologique des interactions entre la cholecystokinine et les enkephalines endogenes dans des models animaux de depression. PhD. thesis, Universite Rene Descartes de Paris.
  • Smith, M.A., Makino, S., Kvetnansky, R. et al., 1995. Stress alters the expression of brain-derived neurotrophic factor and neurotrophin-3 mRNAs in the hippocampus, Journal of Neuroscience. 15, 1768-1777.
  • Starkstein, S.E. & Robinson, R.G., 1989. Affective disorders and cerebral vascular disease. Brit. J. Psychiatry 154, 170-182.
  • Starkstein, S.E. & Robinson, R.G., 1996. Mood disorders in neurodegenerative diseases. Semin. Clin. Neuropsychiatry 4, 272-281.
  • Stewart C. e Reid I., 1993. Electroconvulsive stimulation and synaptic plasticity. Brain Research 620, 139-141.
  • Stewart C. e Reid I., 2000. Repeated ECS and Fluoxetine administration have equivalent effects on hippocampal synaptic plasticity. Psycopharmacology 48, 217-223.
  • Stock H.S. e al., 2001. Changes in defensive behaviors following olfactory bulbectomy in male e female rats. Brain Res. 903, 242-246.
  • Stockmeier C.A., Shapiro L.A., Dillery G.E., Kolly T.N., Friedman L., Rajkoska G., 1998. Increase in serotonin-1A autoreceptors in the midbrain of suicide victims with major depression: post-mortem evidence for decreased serotonin activity. J. neourosci. 18, 7394-7401.
  • Sullivan, P.F., Neale, M.C., Kendler, K.S., 2000. Genetic epidemiology of major depression: review and meta-analysis. Am. J. Psychiatry 157,
  • Suomi S.J., 1982. Relevance of animal models for clinical psychology. In: P.C. Kandel, J.N. Butcher, eds: Handbook of Reserch Methods in Clinical Psychology. New York: Wiley, 249-271.
  • Suppes T.McElroy S.L., Gilbert J., Dessain E.C., Cole J.O., 1992. Clozapine in the treatment of dysphoric mania. Biol. Psychiatry 32, 270-80.
  • Suppes T., Rush A.J., Webb A., Carmody T., Kraemer H., 1996. One year randomized trial clozapine vs. ususal care in bipolar I patients. Biol. Psychiatry 39, 531.
  • Sweatt, J.D., 2001. The neuronal MAP kinase cascade: a biochemical signal integration system subserving synaptic plasticity and memory. J. Neurochem. 76, 1-10.
  • Thoen M., Zarate C.A.Jr., Centorrino F., 1996. Risperidone in the treatment of mania. J. Clin. Psychiatry 57, 249-53.
  • Thoen M., Sanger T., Tollefson G.D., McElroy S.L., 1997. Olanzapine vs. Haloperidol in the treatment of schizoaffective bipolar patients. May 1997 Annual Meeting of American Psychiatric Association, San Diego, California 17-22.
  • Tiihonen J., Vartianen H., Hakola P., 1995. Carbamazepine-induced changes in plasma levels of neuroleptics. Pharmacopsychiatry ;28, 26-8 (letter).
  • Tohen M., Sanger T.M., McElroy S.L., Tollefson G.D., Chengappa K.N., Daniel D.G. et al., 1999. Olanzapine versus placebo in the treatment of acute mania. Olanzapine. H.G.E.H. Study Group. Am. J. Psychiatry 156, 702-9.
  • Tollefson G.D., Beasley C.M., Tran P.V., Steet J.S., 1997. Olanzapine vs. Haloperidol in the treatment of schizophrenia and schizoaffective and schizophreniform disorders:results of an international collaboration. Am. J. Psychiatry 154, 457-65.
  • Tomlison C.W., 1996. Risperidone and mania. Am. J. Psychiatry 153, 132-3.
  • Vieta E., Herraiz M., Fernandez A., Gasto C., Benabarre A., Colom F. et al., 2001. Efficacy and safety of risperidone in the treatment of schizoaffective disorder: initial results from a large, multicenter surveillance study. Group for the Study of Risperidone in Affective Disorders (GSRAD). J. Clin. Psychiatry 62, 623-30.
  • Vieta E., Reinares M., Corbella B., Benabarre A., Gilaberte I., Colom F. et al., 2001. Olanzapine as long-term adjunctive therapy in treatment-resistant bipolar disorder. J. Clin. Psychopharmacol. 21, 469-73.
  • Vieta E., Parramon G., Padrell E., Nieto E., Martinez-Aran A., Corbella B., Colom F., Reinares M., Goikolea J.M., Torrent C., 2002. Quetiapine in the treatment of rapid cycling bipolar disorder. Bipolar Disord. 4, 335-40.
  • Wagner, H.R., Hall, T.L., Cote, I.L., 1977. The applicability of inescapable shock as a source of animal depression. J. Gen. Psychol. 96, 313-318.
  • Wei Z., Mousseau D.D., Richardson J.S., Dyck L.E., Xin-Min L., 2003. Atypical antipsychotics attenuate neurotoxicity of ß-amyloid (25-35) by modulating Bax and Bcl-XL/S expression and localization. J. Neurosci. Res. 74, 942-947.
  • Weisman, M.M., Leaf, P.J., Tischler, G.L., 1998. Affective disorders in five United States communities. Psychol. Med. 18, 141-15.
  • Weiss, J.M. and Kilts, C.D., 1998. Animal models of depression and schizophrenia. In Textbook of Psychopharmacology (2nd edn) (Nemeroff, C.B. and Schatzberg, A.F., eds), American Psychiatric Press, 88-123.
  • West, C.H., Weiss, J.M., 1998. Effects of antidepressant drugs on rats bred for low activity in the swim test. Pharmacol. Biochem. Behav. 61, 67-79.
  • West, C.H., Bonsall, R.W., Emery, M.S.,Weiss, J.M., 1999. Rats selectively bred for high and low swim-test activity show differential responses to dopaminergic drugs. Psychopharmacology Berl. 146, 241-251.
  • Willner P., 1984. The validity of animal models of depression. Psychopharmacology 83, 1-16.
  • Willner P., 1985. Depression: A Psychobiological Synthesis. New York, J. Wiley & Sons.
  • Willner P., Towell A., Sampson D., Sophokleous S., Muscat R., 1987. Reduction of sucrose preference by chronic mild stress and its restoration by a tricyclic antidepressant. Psychopharmacology 93, 358-364.
  • Willner P., 1990. Animal models of depression: an overview. Pharmacol. Ther. 45, 425-455.
  • Willner P., 1991. Animal models as simulations of depression. Trends Pharmacol. Sci. 12, 131-136.
  • Willner P., Klimek V., Golembiowska K., Muscat R., 1991. Changes in mesolimbic dopamine may explain stress-induced anhedonia. Psychobiology 19, 79-84.
  • Willner P., Muscat R., Papp M., 1992. Chronic mild stress-induced anhedonia: a realistic animal model of depression. Neurosci. Biobehav. Rev. 16, 525-534.
  • Willner P., Lappas S., Cheeta S., Muscat R., 1994. Reversal of stress-induced anhedonia by the dopamine receptor agonist, pramipexole. Psychopharmacology 115, 454-462.
  • Willner P., 1995. Dopaminergic mechanisms in depression and mania. In Psychopharmacology: The Fourth Generation of Progress. (eds. Bloom, F.E. & Kupfer, D.J.) (Raven, New York) 921-932.
  • Willner P., 1995a. Animal models of depression: Validity and applications. In: Gessa G.L., Fratta W., Pani L., Serra G., Gessa G. (eds) Depression and mania: from neurobiology to treatment. Raven Press, New York, 19-41.
  • Willner P., 1995b. Dopamine D2/D3 receptors as a potential target for antidepressant drug action. Clin. Neuropharmacol. 18 (Suppl 1) S49-S56.
  • Willner P., Papp M., 1997. Animal models to detect antidepressants: are new strategies necessary to detect new agents? In: Willner, P. Validity, reliability and utility of the chronic mild stress model of depression: a 10- year review and evaluation. Psychopharmacology Berl. 134, 319-329.
  • Wilson W., 1995. Do anticonvulsivant hinder clozapine treatment? Biol. psychiatry 37, 132-3.
  • Wrynn A.S. e al., 2000. An in-vivo magnetic resonance imaging study of the olfactory bulbectomized rat model of depression. Brain Res. 879, 193-199.
  • Xu, L., Holscher, C., Anwyl, R. et al., 1998. Glucocorticoid receptor and protein/RNA synthesis dependent mechanisms underlie the control of synaptic plasticity by stress. Proceedings of the National Academy of Sciences of the USA, 95, 3204-3208.
  • Yadid, G., 1998. The need for cautiously extrapolating results obtained with normal animals (healthy individuals) to depressed ones. J. Neurochem. 70, 2642.
  • Zarate C.A.Jr., Tohen M., Banov M.D., Weiss M.K., Cole J.O., 1995b. Is clozapine a mood stabilizer? J. Clin. Psychiatry 56, 108-12.
  • Zarate C.A.Jr., Narendran R., Tohen M., Greaney J.J., Berman A., Pike S. et al., 1998. Clinical predictors of acute response with olanzapine in psychotic mood disorders. J. Clin. Psychiatry 59, 24-8.
  • Zarate C.A.Jr., Tohen M., 2000a. Antipsycotic drug treatment in first-episode mania:a 6-month longitudinal study. J. Clin. Psychiatry 61, 33-8.
  • Zarate C.A.Jr., Rothschild A., Fletcher K.E., Madrid A., Zapatel J., 2000b. Clinical predictors of acute response with quetiapine in psychotic mood disorders. J. Clin. Psychiatry 61, 185-9.
  • Zhou D. e al., 1998. Serotonergic hyperinnervation of the frontal cortex in an animal model of depression, the bulbectomized rat. J. Neurosci. Res. 54, 109-116.
  • Zilles K., 1992. Neuronal plasticity as an adaptive property of the central nervous system. Ann. Anat.174, 383-391.









Document Info


Accesari: 10445
Apreciat:

Comenteaza documentul:

Nu esti inregistrat
Trebuie sa fii utilizator inregistrat pentru a putea comenta


Creaza cont nou

A fost util?

Daca documentul a fost util si crezi ca merita
sa adaugi un link catre el la tine in site

Copiaza codul
in pagina web a site-ului tau.




eCoduri.com - coduri postale, contabile, CAEN sau bancare

Politica de confidentialitate




Copyright © Contact (SCRIGROUP Int. 2022 )